RegulonDB RegulonDB 10.9: Gene Sequence
dsdA gene sequence


Size: 1329        A: 316  T: 337  G: 362  C: 314

Fasta

 

>dsdA E. coli K12. Version NC_000913.3 GI:556503834
atggaaaacgctaaaatgaactcgctcatcgcccagtatccgttggtaaaggatctggtt
gctcttaaagaaaccacctggtttaatcctggcacgacctcattggctgaaggtttacct
tatgttggcctgaccgaacaggatgttcaggacgcccatgcgcgcttatcccgttttgca
ccctatctggcaaaagcatttcctgaaactgctgccactggggggattattgaatcagaa
ctggttgccattccagctatgcaaaaacggctggaaaaagaatatcagcaaccgatcagc
gggcaactgttactgaaaaaagatagccatttgcccatttccggctccataaaagcacgc
ggcgggatttatgaagtcctggcacacgcagaaaaactggctctggaagcggggttgctg
acgcttgatgatgactacagcaaactgctttctccggagtttaaacagttctttagccaa
tacagcattgctgtgggctcaaccggaaatctggggttatcaatcggcattatgagcgcc
cgcattggctttaaggtgacagttcatatgtctgctgatgcccgggcatggaaaaaagcg
aaactgcgcagccatggcgttacggtcgtggaatatgagcaagattatggtgttgccgtc
gaggaaggacgtaaagcagcgcagtctgacccgaactgtttctttattgatgacgaaaat
tcccgcacgttgttccttgggtattccgtcgctggccagcgtcttaaagcgcaatttgcc
cagcaaggccgtatcgtcgatgctgataaccctctgtttgtctatctgccgtgtggtgtt
ggcggtggtcctggtggcgtcgcattcgggcttaaactggcgtttggcgatcatgttcac
tgcttttttgccgaaccaacgcactccccttgtatgttgttaggcgtccatacaggatta
cacgatcagatttctgttcaggatattggtatcgacaaccttaccgcagcggatggcctt
gcagttggtcgcgcatcaggctttgtcgggcgggcaatggagcgtctgctggatggcttc
tatacccttagcgatcaaaccatgtatgacatgcttggctggctggcgcaggaagaaggt
attcgtcttgaaccttcggcactggcgggtatggccggacctcagcgcgtgtgtgcatca
gtaagttaccaacagatgcacggtttcagcgcagaacaactgcgtaataccactcatctg
gtgtgggcgacgggaggtggaatggtgccggaagaagagatgaatcaatatctggcaaaa
ggccgttaa
              
                            

Download fasta file
RegulonDB