RegulonDB RegulonDB 10.10: Gene Sequence
dsdX gene sequence


Size: 1338        A: 289  T: 397  G: 340  C: 312

Fasta

 

>dsdX E. coli K12. Version NC_000913.3 GI:556503834
atgcactctcaaatctgggttgtgagcacgctgcttatcagcatcgtgttaattgtactg
accatcgtgaagttcaaattccacccgtttctggcgctgttgctggccagcttcttcgtg
ggaacgatgatgggcatggggccactggatatggtaaatgctattgaaagtggaattggc
ggaacgctggggttcctcgcagcggttatcggccttggcacgatactgggaaaaatgatg
gaagtatccggggccgcagaaagaattggtctgacacttcaacgctgccgctggctttca
gttgatgtcattatggtgctggttggcctgatttgtggcatcacgctgtttgttgaagtg
ggcgtcgtgctattgattcctctggctttttcaattgccaaaaaaaccaatacctcatta
ttaaagcttgccattccgctatgtaccgcattgatggcagtgcactgcgtggttcctcca
catccggctgctttatatgttgccaataagctgggcgcagatatcggttcggtgatcgtc
tacggtttgctggttgggctgatggcatcactgatcggtggcccacttttccttaaattt
ctgggtcaacgactgccctttaaacctgtacccacagagtttgcagatctcaaagttcgc
gatgaaaaaacactaccgtcattaggcgcaacgttattcaccatactgctacccattgcg
ctgatgttggttaaaacgattgccgaattgaatatggcgcgtgagagtggtttgtatatc
ttggttgagtttattggcaaccctatcactgccatgtttatcgccgtgtttgtcgcctat
tatgtgttgggtatacgccagcatatgagcatggggacgatgctcacacatacggaaaat
ggcttcggttctattgctaatattttgctgattatcggggccggaggcgcattcaacgcc
attttaaaaagcagcagtctcgctgatacgctggcagttattctctccaatatgcatatg
cacccgattcttctggcctggttagtggctcttattctgcatgcggcagtgggctccgct
accgtggcaatgatgggggcaacggcaattgttgcacccatgctgccgctgtatcccgac
atcagcccggaaattattgcgattgctatcggttcaggtgcaattggctgcactatcgtt
acggactcgcttttctggctagtgaagcaatattgcggcgctacgctcaatgaaacattt
aaatactatacgacagcgacatttatcgcttcagtcgtcgctctggcgggcacattcctg
ctgtcatttatcatctaa
              
                            

Download fasta file
RegulonDB