RegulonDB RegulonDB 10.9: Gene Sequence
eco gene sequence


Size: 489        A: 138  T: 109  G: 134  C: 108

Fasta

 

>eco E. coli K12. Version NC_000913.3 GI:556503834
atgaagaccattctacctgcagtattgtttgccgctttcgctaccacttccgcctgggcg
gcagaaagcgtccagccactggaaaaaatcgcgccttatccacaagctgaaaaagggatg
aagcgtcaggtgattcagttaaccccgcaagaagatgaatctaccctgaaagtagaactg
ttaatcggtcagacgctggaagtcgattgcaatttgcatcgtctcggcgggaagctggaa
aacaaaacgctggaaggctggggctatgattattatgtctttgataaagtcagttccccg
gtttcaacgatgatggcctgcccggatggcaagaaagagaagaaatttgtcaccgcgtat
ctgggcgatgctggaatgctgcgttacaacagcaagctgccgatcgtggtgtatacgcca
gacaatgtagatgtgaagtaccgcgtctggaaggcggaagagaaaattgacaacgcggta
gttcgctaa
              
                            

Download fasta file
RegulonDB