RegulonDB RegulonDB 10.9: Gene Sequence
entA gene sequence


Size: 747        A: 156  T: 158  G: 242  C: 191

Fasta

 

>entA E. coli K12. Version NC_000913.3 GI:556503834
atggatttcagcggtaaaaatgtctgggtaaccggcgcaggtaaaggtatcggctacgcc
acggcgctggcgtttgttgaggcgggagcgaaagttacaggttttgatcaagcgttcact
caggagcaatatccctttgcgaccgaagtgatggatgttgccgacgctgcgcaggtcgcg
caagtgtgtcagcgactgttagctgaaacggagcgactggacgcgctggtcaatgcggcg
ggaattttacgcatgggcgcgaccgatcagctcagtaaagaggactggcagcagactttt
gcggttaacgtcggcggtgcgtttaacctgttccagcaaaccatgaaccagtttcgccgt
cagcggggcggggcgattgtcactgtggcgtccgacgccgcgcacacgccgcgtattggc
atgagtgcttatggcgcatcgaaagcggcgctgaaaagcctggcgttgagcgtcgggctg
gaactggcgggtagcggcgtgcgctgtaatgtggtttcgcctggctccaccgacaccgat
atgcaacgcacgctgtgggtgagcgatgacgccgaagaacagcgtattcgcggctttggc
gagcagtttaaactcggcattccgctggggaaaatcgcccgtccacaagagatcgccaac
acgattttgttcctcgcctctgacctcgccagccatattaccctacaggatattgtggtc
gatggcggctcaacgctgggggcataa
              
                            

Download fasta file
RegulonDB