RegulonDB RegulonDB 10.10: Gene Sequence
entB gene sequence


Size: 858        A: 196  T: 187  G: 257  C: 218

Fasta

 

>entB E. coli K12. Version NC_000913.3 GI:556503834
atggctattccaaaattacaggcttacgcactgccggagtctcacgatattccgcagaat
aaagttgactgggcctttgaaccgcaacgtgccgcgttgttaatccatgatatgcaggac
tattttgtcagcttctggggcgagaactgcccgatgatggagcaggtgatcgcgaatatt
gctgcgctgcgcgactactgcaaacagcacaatatcccggtttattacaccgcccagccg
aaagagcagagcgatgaagatcgggcgctgttgaatgatatgtgggggccgggcctgacc
cgctcgccggaacagcaaaaggtggtggatcgcctgacgccagatgccgacgacacggtg
ctggtgaagtggcgctacagcgcgtttcatcgttctccgctggagcaaatgctgaaagag
agtggacgtaaccagctgattattaccggggtatatgcccacattggctgtatgaccacc
gcaaccgacgcatttatgcgcgatattaaaccgtttatggtggcggatgcgctggccgat
ttcagccgtgacgagcatttgatgtcgctgaaatatgtggccggacgttctggccgggtg
gtgatgactgaagaattactgccagcacctatccccgccagcaaagcggcgctgcgtgag
gtgatcctgccgttgctggacgagtccgatgaaccgttcgatgacgacaacctgatcgac
tacggtctggattcggtgcgcatgatggcgctggcggcgcgctggcgcaaagtgcatggt
gatatcgactttgtcatgctggcgaaaaacccgaccatcgacgcctggtggaagctactc
tcccgcgaggtgaaataa
              
                            

Download fasta file
RegulonDB