RegulonDB RegulonDB 10.9: Gene Sequence
entD gene sequence


Size: 621        A: 171  T: 155  G: 151  C: 144

Fasta

 

>entD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaactacgcatacctccctcccctttgccggacatacgctgcattttgttgagttc
gatccggcgaatttttgtgagcaggatttactctggctgccgcactacgcacaactgcaa
cacgctggacgtaaacgtaaaacagagcatttagccggacggatcgctgctgtttatgct
ttgcgggaatatggctataaatgtgtgcccgcaatcggcgagctacgccaacctgtctgg
cctgcggaggtatacggcagtattagccactgtgggactacggcattagccgtggtatct
cgtcaaccgattggcattgatatagaagaaattttttctgtacaaaccgcaagagaattg
acagacaacattattacaccagcggaacacgagcgactcgcagactgcggtttagccttt
tctctggcgctgacactggcattttccgccaaagagagcgcatttaaggcaagtgagatc
caaactgatgcaggttttctggactatcagataattagctggaataaacagcaggtcatc
attcatcgtgagaatgagatgtttgctgtgcactggcagataaaagaaaagatagtcata
acgctgtgccaacacgattaa
              
                            

Download fasta file
RegulonDB