RegulonDB RegulonDB 10.9: Gene Sequence
entE gene sequence


Size: 1611        A: 351  T: 357  G: 468  C: 435

Fasta

 

>entE E. coli K12. Version NC_000913.3 GI:556503834
atgagcattccattcacccgctggccggaagagtttgcccgtcgctatcgggaaaaaggc
tactggcaggatttgccgctgaccgacattctgacgcgacatgctgcgagtgacagcatc
gcggttatcgacggcgagcgacagttgagttatcgggagctgaatcaggcggcggataac
ctcgcgtgtagtttacgccgtcagggcattaaacctggtgaaaccgcgctggtacaactg
ggtaacgtcgctgaattgtatattacctttttcgcgctgctgaaactgggcgttgcgccg
gtgctggcgttgttcagccatcagcgtagtgaactgaacgcctatgccagccagattgaa
cccgcattgctgattgccgatcgccaacatgcgctgtttagcggggatgatttcctcaat
actttcgtcacagaacattcctccattcgcgtggtgcaactgctcaacgacagcggtgag
cataacttgcaggatgcgattaaccatccggctgaggattttactgccacgccatcacct
gctgatgaagtggcctatttccagctttccggtggcaccaccggcacaccgaaactgatc
ccgcgcactcataacgactactactacagcgtgcgtcgtagcgtcgagatttgtcagttc
acacaacagacacgctacctgtgcgcgatcccggcggctcataactacgccatgagttcg
ccaggatcgctgggcgtctttcttgccggaggaacggttgttctggcggccgatcccagc
gccacgctctgtttcccattgattgaaaaacatcaggttaacgttaccgcgctggtgcca
cccgcagtcagcctgtggttgcaggcgctgatcgaaggcgaaagccgggcgcagcttgcc
tcgctgaaactgttacaggtcggcggcgcacgtctttctgccacccttgcggcgcgtatt
cccgctgagattggctgtcagttgcagcaggtgtttggcatggcggaagggctggtgaac
tacacccgacttgatgatagcgcggagaaaattatccatacccagggttacccaatgtgt
ccggatgacgaagtatgggttgccgatgccgaaggaaatccactgccgcaaggggaagtc
ggacgcctgatgacgcgcgggccgtacaccttccgcggctattacaaaagtccacagcac
aatgccagcgcctttgatgccaacggtttttactgttccggcgatctgatctctattgat
ccagagggttacatcaccgtgcaggggcgcgagaaagatcagattaaccgtggcggcgag
aagatcgctgccgaagagatcgaaaacctgctgctgcgccacccggcggtgatctacgcc
gcactggtgagcatggaagatgagctgatgggcgaaaaaagctgcgcttatctggtggta
aaagagccgctgcgcgcggtgcaggtgcgtcgtttcctgcgtgaacagggtattgccgaa
tttaaattaccggatcgcgtggagtgtgtggattcacttccgctgacggcggtcgggaaa
gtcgataaaaaacaattacgtcagtggctggcgtcacgcgcatcagcctga
              
                            

Download fasta file
RegulonDB