RegulonDB RegulonDB 10.9: Gene Sequence
lpxC gene sequence


Size: 918        A: 212  T: 237  G: 237  C: 232

Fasta

 

>lpxC E. coli K12. Version NC_000913.3 GI:556503834
atgatcaaacaaaggacacttaaacgtatcgttcaggcgacgggtgtcggtttacatacc
ggcaagaaagtcaccctgacgttacgccctgcgccggccaacaccggggtcatctatcgt
cgcaccgacttgaatccaccggtagatttcccggccgatgccaaatctgtgcgtgatacc
atgctctgtacgtgtctggtcaacgagcatgatgtacggatttcaaccgtagagcacctc
aatgctgctctcgcgggcttgggcatcgataacattgttatcgaagttaacgcgccggaa
atcccgatcatggacggcagcgccgctccgtttgtatacctgctgcttgacgccggtatc
gacgagttgaactgcgccaaaaaatttgttcgcatcaaagagactgttcgtgtcgaagat
ggcgataagtgggctgaatttaagccgtacaatggtttttcgctggatttcaccatcgat
tttaaccatccggctattgattccagcaaccagcgctatgcgatgaacttctccgctgat
gcgtttatgcgccagatcagccgtgcgcgtacgttcggtttcatgcgtgatatcgaatat
ctgcagtcccgtggtttgtgcctgggcggcagcttcgattgtgccatcgttgttgacgat
tatcgcgtactgaacgaagacggcctgcgttttgaagacgaatttgtgcgtcacaaaatg
ctcgatgcgatcggtgacttgttcatgtgtggtcacaatattattggtgcatttaccgct
tataaatccggtcatgcactgaataacaaactgctgcaggctgtcctggcgaaacaggaa
gcctgggaatatgtgaccttccaggacgacgcagaactgccgttggccttcaaagcgcct
tcagctgtactggcataa
              
                            

Download fasta file
RegulonDB