RegulonDB RegulonDB 10.10: Gene Sequence
exbB gene sequence


Size: 735        A: 164  T: 181  G: 213  C: 177

Fasta

 

>exbB E. coli K12. Version NC_000913.3 GI:556503834
gtgggtaataatttaatgcagacggacctttccgtctggggtatgtatcagcacgccgat
attgtcgttaagtgcgtgatgattgggcttattttggcctccgtagtcacctgggcaatc
ttcttcagtaagagcgtagagttcttcaatcagaagcgtcgccttaagcgcgagcagcaa
ctgctggctgaagcgcgttccttaaaccaggccaacgatatcgccgctgattttggtagc
aaaagcttaagcctgcatttgctcaatgaagcgcagaatgagctggaactgtcagaaggc
agcgacgataacgaaggtattaaagaacgtaccagcttccgtctggagcgtcgggtcgcc
gcagtgggtcgtcaaatgggccgcggtaacggctatctggcaaccatcggcgcgatttct
ccgttcgttggtctgtttggtacggtctggggcatcatgaacagctttattggtatcgcg
caaacgcagaccactaacctggcagtcgttgcgccgggtatcgcagaagctctgttagca
acggcaatcggcctcgtggcagcgattcctgcggtcgttatctataacgtatttgcacgc
cagattggcggctttaaagcgatgctgggtgatgttgcagcgcaggtattgttgctgcaa
agccgtgacctggatctggaagccagcgccgctgcgcatccggttcgtgtcgcacaaaaa
ttacgcgcaggataa
              
                            

Download fasta file
RegulonDB