RegulonDB RegulonDB 10.10: Gene Sequence
accB gene sequence


Size: 471        A: 131  T: 96  G: 123  C: 121

Fasta

 

>accB E. coli K12. Version NC_000913.3 GI:556503834
atggatattcgtaagattaaaaaactgatcgagctggttgaagaatcaggcatctccgaa
ctggaaatttctgaaggcgaagagtcagtacgcattagccgtgcagctcctgccgcaagt
ttccctgtgatgcaacaagcttacgctgcaccaatgatgcagcagccagctcaatctaac
gcagccgctccggcgaccgttccttccatggaagcgccagcagcagcggaaatcagtggt
cacatcgtacgttccccgatggttggtactttctaccgcaccccaagcccggacgcaaaa
gcgttcatcgaagtgggtcagaaagtcaacgtgggcgataccctgtgcatcgttgaagcc
atgaaaatgatgaaccagatcgaagcggacaaatccggtaccgtgaaagcaattctggtc
gaaagtggacaaccggtagaatttgacgagccgctggtcgtcatcgagtaa
              
                            

Download fasta file
RegulonDB