RegulonDB RegulonDB 10.10: Gene Sequence
accC gene sequence


Size: 1350        A: 339  T: 290  G: 358  C: 363

Fasta

 

>accC E. coli K12. Version NC_000913.3 GI:556503834
atgctggataaaattgttattgccaaccgcggcgagattgcattgcgtattcttcgtgcc
tgtaaagaactgggcatcaagactgtcgctgtgcactccagcgcggatcgcgatctaaaa
cacgtattactggcagatgaaacggtctgtattggccctgctccgtcagtaaaaagttat
ctgaacatcccggcaatcatcagcgccgctgaaatcaccggcgcagtagcaatccatccg
ggttacggcttcctctccgagaacgccaactttgccgagcaggttgaacgctccggcttt
atcttcattggcccgaaagcagaaaccattcgcctgatgggcgacaaagtatccgcaatc
gcggcgatgaaaaaagcgggcgtcccttgcgtaccgggttctgacggcccgctgggcgac
gatatggataaaaaccgtgccattgctaaacgcattggttatccggtgattatcaaagcc
tccggcggcggcggcggtcgcggtatgcgcgtagtgcgcggcgacgctgaactggcacaa
tccatctccatgacccgtgcggaagcgaaagctgctttcagcaacgatatggtttacatg
gagaaatacctggaaaatcctcgccacgtcgagattcaggtactggctgacggtcagggc
aacgctatctatctggcggaacgtgactgctccatgcaacgccgccaccagaaagtggtc
gaagaagcgccagcaccgggcattaccccggaactgcgtcgctacatcggcgaacgttgc
gctaaagcgtgtgttgatatcggctatcgcggtgcaggtactttcgagttcctgttcgaa
aacggcgagttctatttcatcgaaatgaacacccgtattcaggtagaacacccggttaca
gaaatgatcaccggcgttgacctgatcaaagaacagctgcgtatcgctgccggtcaaccg
ctgtcgatcaagcaagaagaagttcacgttcgcggccatgcggtggaatgtcgtatcaac
gccgaagatccgaacaccttcctgccaagtccgggcaaaatcacccgtttccacgcacct
ggcggttttggcgtacgttgggagtctcatatctacgcgggctacaccgtaccgccgtac
tatgactcaatgatcggtaagctgatttgctacggtgaaaaccgtgacgtggcgattgcc
cgcatgaagaatgcgctgcaggagctgatcatcgacggtatcaaaaccaacgttgatctg
cagatccgcatcatgaatgacgagaacttccagcatggtggcactaacatccactatctg
gagaaaaaactcggtcttcaggaaaaataa
              
                            

Download fasta file
RegulonDB