RegulonDB RegulonDB 10.9: Gene Sequence
fabH gene sequence


Size: 954        A: 206  T: 226  G: 282  C: 240

Fasta

 

>fabH E. coli K12. Version NC_000913.3 GI:556503834
atgtatacgaagattattggtactggcagctatctgcccgaacaagtgcggacaaacgcc
gatttggaaaaaatggtggacacctctgacgagtggattgtcactcgtaccggtatccgc
gaacgccacattgccgcgccaaacgaaaccgtttcaaccatgggctttgaagcggcgaca
cgcgcaattgagatggcgggcattgagaaagaccagattggcctgatcgttgtggcaacg
acttctgctacgcacgctttcccgagcgcagcttgtcagattcaaagcatgttgggcatt
aaaggttgcccggcatttgacgttgcagcagcctgcgcaggtttcacctatgcattaagc
gtagccgatcaatacgtgaaatctggggcggtgaagtatgctctggtcgtcggttccgat
gtactggcgcgcacctgcgatccaaccgatcgtgggactattattatttttggcgatggc
gcgggcgctgcggtgctggctgcctctgaagagccgggaatcatttccacccatctgcat
gccgacggtagttatggtgaattgctgacgctgccaaacgccgaccgcgtgaatccagag
aattcaattcatctgacgatggcgggcaacgaagtcttcaaggttgcggtaacggaactg
gcgcacatcgttgatgagacgctggcggcgaataatcttgaccgttctcaactggactgg
ctggttccgcatcaggctaacctgcgtattatcagtgcaacggcgaaaaaactcggtatg
tctatggataatgtcgtggtgacgctggatcgccacggtaatacctctgcggcctctgtc
ccgtgcgcgctggatgaagctgtacgcgacgggcgcattaagccggggcagttggttctg
cttgaagcctttggcggtggattcacctggggctccgcgctggttcgtttctag
              
                            

Download fasta file
RegulonDB