RegulonDB RegulonDB 10.8: Gene Sequence
fadB gene sequence


Size: 2190        A: 539  T: 442  G: 625  C: 584

Fasta

 

>fadB E. coli K12. Version NC_000913.3 GI:556503834
atgctttacaaaggcgacaccctgtaccttgactggctggaagatggcattgccgaactg
gtatttgatgccccaggttcagttaataaactcgacactgcgaccgtcgccagcctcggc
gaggccatcggcgtgctggaacagcaatcagatctaaaagggctgctgctgcgttcgaac
aaagcagcctttatcgtcggtgctgatatcaccgaatttttgtccctgttcctcgttcct
gaagaacagttaagtcagtggctgcactttgccaatagcgtgtttaatcgcctggaagat
ctgccggtgccgaccattgctgccgtcaatggctatgcgctgggcggtggctgcgaatgc
gtgctggcgaccgattatcgtctggcgacgccggatctgcgcatcggtctgccggaaacc
aaactgggcatcatgcctggctttggcggttctgtacgtatgccacgtatgctgggcgct
gacagtgcgctggaaatcattgccgccggtaaagatgtcggcgcggatcaggcgctgaaa
atcggtctggtggatggcgtagtcaaagcagaaaaactggttgaaggcgcaaaggcggtt
ttacgccaggccattaacggcgacctcgactggaaagcaaaacgtcagccgaagctggaa
ccactaaaactgagcaagattgaagccaccatgagcttcaccatcgctaaagggatggtc
gcacaaacagcggggaaacattatccggcccccatcaccgcagtaaaaaccattgaagct
gcggcccgttttggtcgtgaagaagccttaaacctggaaaacaaaagttttgtcccgctg
gcgcataccaacgaagcccgcgcactggtcggcattttccttaacgatcaatatgtaaaa
ggcaaagcgaagaaactcaccaaagacgttgaaaccccgaaacaggccgcggtgctgggt
gcaggcattatgggcggcggcatcgcttaccagtctgcgtggaaaggcgtgccggttgtc
atgaaagatatcaacgacaagtcgttaaccctcggcatgaccgaagccgcgaaactgctg
aacaagcagcttgagcgcggcaagatcgatggtctgaaactggctggcgtgatctccaca
atccacccaacgctcgactacgccggatttgaccgcgtggatattgtggtagaagcggtt
gttgaaaacccgaaagtgaaaaaagccgtactggcagaaaccgaacaaaaagtacgccag
gataccgtgctggcgtctaacacttcaaccattcctatcagcgaactggccaacgcgctg
gaacgcccggaaaacttctgcgggatgcacttctttaacccggtccaccgaatgccgttg
gtagaaattattcgcggcgagaaaagctccgacgaaaccatcgcgaaagttgtcgcctgg
gcgagcaagatgggcaagacgccgattgtggttaacgactgccccggcttctttgttaac
cgcgtgctgttcccgtatttcgccggtttcagccagctgctgcgcgacggcgcggatttc
cgcaagatcgacaaagtgatggaaaaacagtttggctggccgatgggcccggcatatctg
ctggacgttgtgggcattgataccgcgcatcacgctcaggctgtcatggcagcaggcttc
ccgcagcggatgcagaaagattaccgcgatgccatcgacgcgctgtttgatgccaaccgc
tttggtcagaagaacggcctcggtttctggcgttataaagaagacagcaaaggtaagccg
aagaaagaagaagacgccgccgttgaagacctgctggcagaagtgagccagccgaagcgc
gatttcagcgaagaagagattatcgcccgcatgatgatcccgatggtcaacgaagtggtg
cgctgtctggaggaaggcattatcgccactccggcggaagcggatatggcgctggtctac
ggcctgggcttccctccgttccacggcggcgcgttccgctggctggacaccctcggtagc
gcaaaatacctcgatatggcacagcaatatcagcacctcggcccgctgtatgaagtgccg
gaaggtctgcgtaataaagcgcgtcataacgaaccgtactatcctccggttgagccagcc
cgtccggttggcgacctgaaaacggcttaa
              
                            

Download fasta file
RegulonDB