RegulonDB RegulonDB 10.9: Gene Sequence
fbaA gene sequence


Size: 1080        A: 285  T: 243  G: 271  C: 281

Fasta

 

>fbaA E. coli K12. Version NC_000913.3 GI:556503834
atgtctaagatttttgatttcgtaaaacctggcgtaatcactggtgatgacgtacagaaa
gttttccaggtagcaaaagaaaacaacttcgcactgccagcagtaaactgcgtcggtact
gactccatcaacgccgtactggaaaccgctgctaaagttaaagcgccggttatcgttcag
ttctccaacggtggtgcttcctttatcgctggtaaaggcgtgaaatctgacgttccgcag
ggtgctgctatcctgggcgcgatctctggtgcgcatcacgttcaccagatggctgaacat
tatggtgttccggttatcctgcacactgaccactgcgcgaagaaactgctgccgtggatc
gacggtctgttggacgcgggtgaaaaacacttcgcagctaccggtaagccgctgttctct
tctcacatgatcgacctgtctgaagaatctctgcaagagaacatcgaaatctgctctaaa
tacctggagcgcatgtccaaaatcggcatgactctggaaatcgaactgggttgcaccggt
ggtgaagaagacggcgtggacaacagccacatggacgcttctgcactgtacacccagccg
gaagacgttgattacgcatacaccgaactgagcaaaatcagcccgcgtttcaccatcgca
gcgtccttcggtaacgtacacggtgtttacaagccgggtaacgtggttctgactccgacc
atcctgcgtgattctcaggaatatgtttccaagaaacacaacctgccgcacaacagcctg
aacttcgtattccacggtggttccggttctactgctcaggaaatcaaagactccgtaagc
tacggcgtagtaaaaatgaacatcgataccgatacccaatgggcaacctgggaaggcgtt
ctgaactactacaaagcgaacgaagcttatctgcagggtcagctgggtaacccgaaaggc
gaagatcagccgaacaagaaatactacgatccgcgcgtatggctgcgtgccggtcagact
tcgatgatcgctcgtctggagaaagcattccaggaactgaacgcgatcgacgttctgtaa
              
                            

Download fasta file
RegulonDB