RegulonDB RegulonDB 10.10: Gene Sequence
fecA gene sequence


Size: 2325        A: 537  T: 427  G: 650  C: 711

Fasta

 

>fecA E. coli K12. Version NC_000913.3 GI:556503834
atgacgccgttacgcgtttttcgtaaaacaacacctttggttaacaccattcgcctgagc
ctgctgccgctggccggtctctcgttttccgcttttgctgcacaggttaatatcgcaccg
ggatcgctcgataaagcgctcaatcagtatgccgcacacagcggatttaccctctcggtt
gacgccagcctgacgcgcggcaagcagagcaacggcctgcacggcgattacgacgtcgag
agcggcctgcaacaactgctggacggcagcggactgcaggtaaaaccgctgggaaataac
agctggacgctggagcccgcgcccgcaccaaaagaagatgccctgaccgtggtcggcgac
tggctgggtgatgcgcgtgaaaacgacgtatttgaacatgctggcgcgcgtgacgtgatc
cgccgtgaggatttcgccaaaaccggcgcaaccaccatgcgtgaggtacttaaccgcatc
cctggcgtcagcgcgccggaaaacaacggcaccggcagccacgacctggcgatgaacttt
ggcatccggggcctgaacccgcgcctcgccagccgctcgaccgtcctgatggacggcatc
cccgtccccttcgccccttacggtcagccgcagctttcactggctcccgtttcgctcggc
aacatggatgccattgacgtggtacgcggtggtggtgcggtgcgttacggaccgcagagc
gtgggcggcgtggtgaactttgttacccgtgccattccgcaggactttggtatcgaggcg
ggcgtggaaggtcagctcagcccaacctcttcacaaaacaacccgaaagagacgcacaac
ctgatggtgggcggcacagcggacaacggttttggcaccgcgctgctctactccggcacg
cgcggcagtgactggcgcgagcacagcgccacccgcatcgacgacctgatgctgaaaagc
aaatatgcgccggatgaggtgcacaccttcaacagcctgctgcaatattacgacggtgaa
gccgacatgcccggtggcctgtctcgcgcggattacgacgccgatcgctggcaatccacc
cgcccgtatgaccgcttctggggtcgtcgcaagctggcgagcctgggctaccagttccag
ccagacagccagcataaattcaacattcaggggttctacacccaaaccctgcgcagcggc
tacctggagcaaggcaaacgcatcaccctctcgccgcgtaactactgggtgcgcggtatt
gagccacgctacagccagatctttatgatcggcccttccgcgcacgaagtgggcgtgggc
tatcgctatttgaatgaatcaacgcatgaaatgcgttactacaccgccaccagcagcggg
cagttgccgtccggctcaagcccttacgaccgcgatacgcgttccggcaccgaggcgcac
gcctggtatctggatgacaaaatcgacatcggcaactggaccatcacgccgggtatgcgt
ttcgaacatatcgagtcataccagaacaacgccatcacaggcacgcacgaagaagtgagc
tataacgcaccgcttccggcgttgaacgtgctctatcacctgactgacagctggaatctt
tatgcaaacactgaaggctcgttcggcaccgtacagtacagccagattggcaaggctgtg
caaagcggcaatgttgaaccggaaaaagcgcgaacctgggaactcggtacccgctacgac
gacggcgcgctgacggcggaaatggggctgttcctgattaactttaacaatcagtacgac
tccaaccagaccaacgacaccgtcactgcacgtggcaaaacgcgccataccgggctggaa
acgcaggcacgttacgatctgggtacgctaacgccaacgcttgataacgtttccatctac
gccagctatgcgtatgtgaacgcggaaatccgcgagaaaggcgacacctacggcaatctg
gtaccattctccccgaaacataaaggcacgctgggcgtggactacaagccaggaaactgg
acgttcaatctgaacagcgatttccagtccagccagtttgcggataacgccaatacggtg
aaagagagcgccgacggcagtaccggccgcattcccggcttcatgctctggggcgcacgc
gtggcgtatgactttggcccgcagatggcagatctgaacctggcattcggtgtgaaaaac
atcttcgaccaggactacttcatccgctcttatgacgacaacaacaaaggcatctatgca
ggccagccgcgcacgctgtatatgcaggggtcgttgaagttctga
              
                            

Download fasta file
RegulonDB