RegulonDB RegulonDB 10.9: Gene Sequence
fecD gene sequence


Size: 957        A: 137  T: 248  G: 296  C: 276

Fasta

 

>fecD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattgcgctggttattttcatcacccttgccctggcgggctgtgcgctgttatca
ctccatatgggagtgatccccgtgccgtggcgcgcgctgctgaccgactggcaggccgga
cacgagcattattatgtattgatggagtaccgactgccgcgcttgctgctggcactgttt
gtcggtgcagccctcgccgtggcgggcgtgctgatacaggggattgtgcgcaaccctctg
gcatcaccggatattctcggtgttaaccatgccgccagcctggcctctgtgggggctcta
cttcttatgccgtcactgcccgtgatggtgctgccgctgctggcctttgcgggcggcatg
gcggggttgatattgctgaagatgctggcaaagacccaccagccgatgaagctggcgctc
accggcgtggcgctttctgcatgctgggccagcctgacggattatctgatgctctcgcgc
ccgcaggatgtgaacaacgccctgctgtggctgaccggcagcttatggggccgtgactgg
agctttgtgaagattgccatcccgctgatgattttatttctgccgctgagcctgagtttt
tgccgcgatctcgacctccttgcactcggcgatgcgcgcgccaccacgctcggtgtgtcg
gtgccccatacccgattctgggctttgttactagctgtcgccatgacatctaccggcgtg
gccgcctgcggcccgattagctttattggtctcgtggtgccgcatatgatgcgtagcatc
accggtggacgtcaccgcagactgctgcctgtttcggccctgacaggtgcgttgctgttg
gtggttgccgatctgctggcgagaattattcatcccccactggagctcccggttggcgtg
ctgaccgccattatcggtgcgccgtggtttgtctggttgcttgtgagaatgcgataa
              
                            

Download fasta file
RegulonDB