RegulonDB RegulonDB 10.9: Gene Sequence
fepB gene sequence


Size: 957        A: 235  T: 195  G: 260  C: 267

Fasta

 

>fepB E. coli K12. Version NC_000913.3 GI:556503834
gtgagactcgccccgctctaccgcaacgcccttctattaacaggacttttgctttcagga
atagccgcagttcaggccgctgactggccgcgtcagattactgacagccgtggcacacat
acactggaaagccagccgcagcgtattgtttccaccagcgtcaccctgaccggctcactg
ctggcgattgatgctccggtgatcgccagcggcgcgaccacgccgaataaccgcgtcgcg
gatgaccagggctttttacgccagtggagcaaggtggcgaaagaacgcaaactgcaacgg
ctctatatcggcgaaccgagcgccgaagccgttgccgcgcaaatgccggatctgatttta
attagcgcaaccggcggggattcggcgctggcactgtatgatcagctttccaccatcgcc
ccgacattaatcatcaattacgacgacaaaagctggcagtcgctgttaacgcaacttggc
gaaattaccgggcatgagaaacaagcggcagagcggattgcgcagtttgataagcaactg
gcggcggcgaaagagcaaatcaaattaccgccgcagccggtcactgccattgtctatact
gccgctgcacacagtgccaatctctggacgccagaatcagcacaagggcagatgctggaa
caactcggctttacgctggcgaagttacccgcagggttaaatgccagccaaagtcagggt
aaacgccatgacatcattcagcttggtggggaaaatctggctgcagggttaaatggcgag
tcactattcctgttcgccggtgatcagaaagatgccgatgctatttatgctaatccgctg
ctcgcgcacctgcctgcagtacaaaacaagcaggtttatgcgctgggaaccgagacgttc
cgtctggattactacagcgccatgcaagtgctggataggcttaaggcgctgttttaa
              
                            

Download fasta file
RegulonDB