RegulonDB RegulonDB 10.9: Gene Sequence
fepD gene sequence


Size: 1005        A: 146  T: 246  G: 320  C: 293

Fasta

 

>fepD E. coli K12. Version NC_000913.3 GI:556503834
atgtctggttctgttgccgtgacacgcgccattgccgtgcccggattgctgttattactg
attatcgcgacggcattaagcctgctcattggggcaaaatcactccccgcttccgtagtg
ctggaggccttctccggcacctgccagagcgccgactgcaccatcgtgctcgacgcgcgg
ctgccgcgtacccttgccggtttactggcaggcggcgcgcttggccttgccggggcgtta
atgcaaaccctcacccgaaacccacttgccgaccccggcttgcttggcgtgaacgccgga
gccagctttgccattgtgctgggtgcggcgctgtttggttactcttccgcgcaggaacaa
ctggcgatggccttcgccggggcgctggtggcctcattgattgttgcctttaccggcagt
cagggcggcgggcagttaagtccggtgcgtttaaccctggcgggcgtggcgctggcggcg
gtgctggaaggactgaccagcggcatcgccctgcttaatcctgacgtctacgatcagttg
cgtttctggcaagccggttcgctggatattcgcaatctacataccttaaaagtggtgctg
atcccggtgctgatcgccggagcaactgcgctattactgagtcgcgcgctgaacagtttg
agcctcggcagcgacaccgcgacggcgctgggcagtcgcgtggcgcgcacacagttgatt
ggtctgctggcgattaccgtgctttgtggtagtgcgacggcaatagttggcccgattgcc
tttattggcctgatgatgccgcatatggcgcgttggctggtgggtgccgatcatcgctgg
tcgctgcccgtcacgctacttgctacccctgccctgctgctgtttgccgatatcatcggg
cgggtgattgtgcccggcgaactgcgcgtttctgtggtcagtgcgtttattggtgcaccg
gtgctgatcttcctcgtgcgacgtaaaacgcgaggtggtgcatga
              
                            

Download fasta file
RegulonDB