RegulonDB RegulonDB 10.9: Gene Sequence
fepG gene sequence


Size: 993        A: 159  T: 256  G: 306  C: 272

Fasta

 

>fepG E. coli K12. Version NC_000913.3 GI:556503834
atgatttacgtctctcgccgattactcatcacctgtttgctgctggtttccgcctgtgtg
gttgcaggtatctggggattacgcagcggtgccgtcacgctggaaacctcgcaggtattc
gccgcgctgatgggcgatgcgccgcgcagtatgacgatggtggtcaccgaatggcgttta
ccacgcgtgctgatggcgctgttgattggcgcagcactgggcgtcagtggcgcgattttt
cagtcgctgatgcgtaacccgctcggcagccctgacgtaatgggctttaacaccggggcg
tggagcggcgtgctggtggcgatggtgctgtttggtcaggacctgacggctatcgcgctg
tcagcaatggtgggcggcattgtcacttcgctgctggtctggctgctcgcctggcgcaac
ggcatcgacacctttcggttgattattatcggtatcggcgttcgcgccatgctggtggcc
tttaatacctggctgttgctgaaagcgtctttagaaacggcgctaacagcaggtttgtgg
aatgccggatcgctcaacggcctgacgtgggcaaaaacctcgccttccgcacccatcatt
atattgatgctcattgccgccgccttactggtacgccggatgcgcttgctggaaatgggc
gatgataccgcgtgtgcgctgggcgtcagcgtcgaacgttcgcgtctgttaatgatgctg
gttgcagtggtgcttaccgctgcggcaacagcgcttgccgggccgatttcctttattgct
ttagtcgcaccgcacattgcccgacgcattagcggcaccgctcgctgggggctaacccag
gcggcgctatgcggggcgctgttactgctggcggccgatctctgcgcccaacaactgttt
atgccgtatcaacttccggttggcgtcgttaccgtcagcctcggcggtatttaccttatc
gtcttgttaattcaggagtctcgcaaaaaatga
              
                            

Download fasta file
RegulonDB