RegulonDB RegulonDB 10.9: Gene Sequence
fes gene sequence


Size: 1203        A: 277  T: 265  G: 349  C: 312

Fasta

 

>fes E. coli K12. Version NC_000913.3 GI:556503834
gtgacggcgttaaaagtaggaagtgagagctggtggcagtcgaaacatggcccggaatgg
cagcgtctgaatgacgaaatgtttgaggtcactttctggtggcgtgatccccaaggttct
gaagaatactcgacgataaagcgcgtatgggtctacatcactggtgtgaccgatcaccat
cagaacagccagccccagtcgatgcagcgaattgcaggcactaacgtctggcagtggacg
acacaactcaatgccaactggcgcggcagctactgctttattcccaccgaacgcgatgac
attttttctgtaccatcccccgatcgcctcgaattgcgcgaaggctggcgaaaactatta
ccccaggcgatagccgatccgctgaacctacaaagctggaaaggcgggcgagggcacgct
gtttctgcactcgaaatgccgcaagcgcctctgcaaccgggatgggattgtccgcaagcg
ccagaaatacctgccaaagaaattatctggaaaagtgaacggttgaaaaagtcacggcgt
gtatggatttttaccaccggcgatgcaacagcagaagaacgcccgctggcagttttgctc
gatggcgaattttgggcgcaaagtatgcccgtctggccagtgctgacttcgctgacccat
cgtcagcaacttcctcccgccgtgtatgtgttgatcgacgctatcgacaccacgcaccgc
gcccacgaactgccgtgtaatgcggatttctggctcgcagtacagcaagagttattaccc
ctggtgaaagctattgccccttttagcgatcgtgccgatcgcaccgtggttgccgggcag
agttttggtgggctttccgcgctgtatgccggactgcactggcctgaacgctttggctgt
gtattaagccagtcaggatcgtactggtggccgcatcggggcgggcagcaagagggcgtg
ttacttgaaaagctaaaagctggtgaagttagcgccgaaggtctgcgcattgtgctggaa
gcgggtattcgcgagccgatgatcatgcgggccaatcaggcgctgtatgcgcaattacac
cccataaaagaatccattttctggcgtcaggttgacggcggacatgatgcgctttgttgg
cgcggtggcttgatgcaggggctaatcgacctctggcaaccacttttccatgacaggagt
tga
              
                            

Download fasta file
RegulonDB