RegulonDB RegulonDB 10.9: Gene Sequence
fhlA gene sequence


Size: 2079        A: 515  T: 471  G: 552  C: 541

Fasta

 

>fhlA E. coli K12. Version NC_000913.3 GI:556503834
atgtcatatacaccgatgagtgatctcggacaacaagggttgttcgacatcactcggaca
ctattgcagcagcccgatctggcctcgctgtgtgaggctctttcgcaactggtaaagcgt
tctgcgctcgccgacaacgcggctattgtgttgtggcaagcgcagactcaacgtgcgtct
tattacgcgtcgcgtgaaaaagacacccccattaaatatgaagacgaaactgttctggca
cacggtccggtacgcagcattttgtcgcgccctgatacgctgcattgcagttacgaagaa
ttttgtgaaacctggccgcagctggacgcaggtgggctatacccaaaatttggtcactat
tgcctgatgccactggcggcggaagggcatatttttggtggctgtgaatttattcgttat
gacgatcgcccctggagcgaaaaagagttcaatcgtctgcaaacatttacgcagatcgtt
tctgtcgtcaccgaacaaatccagagccgcgtcgttaacaatgtcgactatgagttgtta
tgccgggaacgcgataacttccgcatcctggtcgccatcaccaacgcggtgctttcccgc
ctggatatggacgaactggtcagcgaagtcgccaaagaaatccattactatttcgacatt
gacgatatcagtatcgtcttacgcagccaccgtaaaaacaaactcaacatctactccact
cactatcttgataaacagcatcccgcccacgaacagagcgaagtcgatgaagccggaacc
ctcaccgaacgcgtgttcaaaagtaaagagatgctgctgatcaatctccacgagcgggac
gatttagccccctatgaacgcatgttgttcgacacctggggcaaccagattcaaaccttg
tgcctgttaccgctgatgtctggcgacaccatgctgggcgtgctgaaactggcgcaatgc
gaagagaaagtgtttaccactaccaatctgaatttactgcgccagattgccgaacgtgtg
gcaatcgctgtcgataacgccctcgcctatcaggaaatccatcgtctgaaagaacggctg
gttgatgaaaacctcgccctgaccgagcagctcaacaatgttgatagtgaatttggcgag
attattggccgcagcgaagccatgtacagcgtgcttaaacaagttgaaatggtggcgcaa
agtgacagtaccgtgctgatcctcggtgaaactggcacgggtaaagagctgattgcccgt
gcgatccataatctcagtgggcgtaataatcgccgcatggtcaaaatgaactgcgcggcg
atgcctgccggattgctggaaagcgatctgtttggtcatgagcgtggggcttttaccggt
gccagcgcccagcgtatcggtcgttttgaactggcggataaaagctccctgttcctcgac
gaagtgggcgatatgccactggagttacagccgaagttgctgcgtgtattgcaggaacag
gagtttgaacgtctcggcagcaacaaaatcattcagacggacgtgcgtctaatcgccgcg
actaaccgcgatctgaaaaaaatggtcgccgaccgtgagttccgtagcgatctctattac
cgcctgaacgtattcccgattcacctgccgccactacgcgagcgtccggaagatattccg
ctgctggcgaaagcctttaccttcaaaattgcccgtcgtctggggcgcaatatcgacagc
attcctgccgagacgctgcgcaccttgagcaacatggagtggccgggtaacgtacgcgaa
ctggaaaacgtcattgagcgcgcggtattgctaacacgcggtaacgtgctgcagctgtca
ttgccagatattgttttaccggaacctgaaacgccgcctgccgcaacggttgtcgccctg
gagggcgaagatgaatatcagttgattgtgcgcgtgctgaaagaaaccaacggcgtggtt
gccgggcctaaaggcgctgcgcaacgtctggggctgaaacgcacgaccctgctgtcacgg
atgaagcggctgggaattgataaatcggcattgatttaa
              
                            

Download fasta file
RegulonDB