RegulonDB RegulonDB 10.9: Gene Sequence
fhuA gene sequence


Size: 2244        A: 551  T: 543  G: 587  C: 563

Fasta

 

>fhuA E. coli K12. Version NC_000913.3 GI:556503834
atggcgcgttccaaaactgctcagccaaaacactcactgcgtaaaatcgcagttgtagta
gccacagcggttagcggcatgtctgtttatgcacaggcagcggttgaaccgaaagaagac
actatcaccgttaccgctgcacctgcgccgcaagaaagcgcatgggggcctgctgcaact
attgcggcgcgacagtctgctaccggcactaaaaccgatacgccgattcaaaaagtgcca
cagtctatttctgttgtgaccgccgaagagatggcgctgcatcagccgaagtcggtaaaa
gaagcgcttagctacacgccgggtgtctctgttggtacgcgtggcgcatccaacacctat
gaccacctgatcattcgcggctttgcggcagaaggccaaagccagaataactatctgaat
ggcctgaagttgcagggcaacttctataacgatgcggtcattgacccgtatatgctggaa
cgcgctgaaattatgcgtggcccggtttccgtgctttacggtaaaagcagtcctggcggc
ctgttgaatatggtcagcaagcgtccgaccaccgaaccgctgaaagaagttcagtttaaa
gccggtactgacagcctgttccagactggttttgactttagcgattcgttggatgatgac
ggtgtttactcttatcgcctgaccggtcttgcgcgttctgccaatgcccagcagaaaggg
tcagaagagcagcgttatgctattgcaccggcgttcacctggcgtccggatgataaaacc
aattttaccttcctttcttacttccagaacgagccggaaaccggttattacggctggttg
ccgaaagagggaaccgttgagccgctgccgaacggtaagcgtctgccgacagactttaat
gaaggggcgaagaacaacacctattctcgtaatgagaagatggtcggctacagcttcgat
cacgaatttaacgacacctttactgtgcgtcagaacctgcgctttgctgaaaacaaaacc
tcgcaaaacagcgtttatggttacggcgtctgctccgatccggcgaatgcttacagcaaa
cagtgtgcggcattagcgccagcggataaaggccattatctggcacgtaaatacgtcgtt
gatgatgagaagctgcaaaacttctccgttgatacccagttgcagagcaagtttgccact
ggcgatatcgaccacaccctgctgaccggtgtcgactttatgcgtatgcgtaatgacatc
aacgcctggtttggttacgacgactctgtgccactgctcaatctgtacaatccggtgaat
accgatttcgacttcaatgccaaagatccggcaaactccggcccttaccgcattctgaat
aaacagaaacaaacgggcgtttatgttcaggatcaggcgcagtgggataaagtgctggtc
accctaggcggtcgttatgactgggcagatcaagaatctcttaaccgcgttgccgggacg
accgataaacgtgatgacaaacagtttacctggcgtggtggtgttaactacctgtttgat
aatggtgtaacaccttacttcagctatagcgaatcgtttgaaccttcttcgcaagttggg
aaggatggtaatattttcgcaccgtctaaaggtaagcagtatgaagtcggcgtgaaatat
gtaccggaagatcgtccgattgtagttactggtgccgtgtataatctcactaaaaccaac
aacctgatggcggaccctgagggttccttcttctcggttgaaggtggcgagatccgcgca
cgtggcgtagaaatcgaagcgaaagcggcgctgtcggcgagtgttaacgtagtcggttct
tatacttacaccgatgcggaatacaccaccgatactacctataaaggcaatacgcctgca
caggtgccaaaacacatggcttcgttgtgggctgactacaccttctttgacggtccgctt
tcaggtctgacgctgggcaccggtggtcgttatactggctccagttatggtgatccggct
aactcctttaaagtgggaagttatacggtcgtggatgcgttagtacgttatgatctggcg
cgagtcggcatggctggctccaacgtggcgctgcatgttaacaacctgttcgatcgtgaa
tacgtcgccagctgctttaacacttatggctgcttctggggcgcagaacgtcaggtcgtt
gcaaccgcaaccttccgtttctaa
              
                            

Download fasta file
RegulonDB