RegulonDB RegulonDB 10.9: Gene Sequence
fhuB gene sequence


Size: 1983        A: 283  T: 515  G: 685  C: 500

Fasta

 

>fhuB E. coli K12. Version NC_000913.3 GI:556503834
gtgagtaaacgaattgcgcttttcccggcgttattgctggcgctgttagtgattgtcgct
acggcgctcacctggatgaacttctcgcaggcgctgccgcgtagccagtgggcgcaggct
gcctggtcgccggatattgacgtcatcgagcagatgatttttcactacagcttgttgccg
cgtctggcgatttcgctgctggtgggcgcgggtctggggctggtgggcgtgctgtttcag
caagtgctgcgtaacccgctggcggagccgacgacgcttggcgttgctacaggcgcgcaa
ctggggattaccgtcactacgctctgggcgatccctggtgcgatggcgagccagtttgct
gcgcaggcaggggcttgtgttgttggcttaattgtctttggcgtcgcgtgggggaaacgg
ctgtcgccggtaacgctgattctcgcggggttggtagtgagcctttattgcggcgcaatc
aatcagttactggttatcttccatcatgaccaactgcaaagcatgtttctgtggagcact
ggaacgctgacgcaaaccgactggggcggcgttgagcgtttatggccgcagctgctgggc
ggtgtgatgctgacgttgctgctacttcgtccgttaaccctgatggggcttgatgatggc
gtggcgcgcaatctcgggctggccttgtcgcttgcgcgtctggcagcgctgtcgctggcg
attgtcatcagtgcgctgctggtgaacgctgtggggattatcggctttatcgggttgttc
gcgccgctgctggcaaaaatgctgggggcgcggcgtctgctgccacgactgatgctggcg
tcgttgattggtgcgctgatcctctggctttccgatcaaatcatcctctggctgactcgc
gtgtggatggaagtgtccaccggttcggtcactgcgttgatcggtgcgccgctgctactg
tggctgttgccgcgtttacgcagcattagcgcgccggatatgaaggtcaacgatcgtgtc
gcggctgaacgccaacatgtgctggcgtttgccctcgcgggcggcgtgctgctgttgatg
gctgtggtggtggcgctgtcgtttggtcgtgatgcgcacggctggacgtgggcgagcggg
gcgttgctcgaggatttaatgccctggcgctggccgcgaattatggcggcgctgtttgcg
ggcgtcatgctggcggtggcgggctgtattattcagcgactgaccggaaacccgatggca
agcccggaagtgctggggattagctccggcgcggcgtttggcgtggtgttgatgctgttt
ctggtgccgggtaatgcctttggctggctgttacctgcaggcagtctcggcgcggcggtg
acgctgttgatcattatgatcgccgccggccgcggtggattttccccacaccgtatgtta
ctggcggggatggcgttaagcaccgcgttcaccatgcttttgatgatgttgcaggcaagt
ggtgacccgcgaatggcgcaagtgctgacctggatttccggttcgacctacaacgcgacc
gatgcgcaggtctggcgcaccggaattgtgatggtgattttgctggcgattaccccgctg
tgccgccgctggctgaccattttaccgctgggtggtgataccgcccgagccgtaggaatg
gcgctgacgccgacgcgaattgcgctgctgctgttagcggcttgcctgacggcgaccgcg
acgatgactattggaccgttgagttttgttggtttaatggcaccgcatattgcgcggatg
atgggctttcgacggacgatgccacacatcgtaatttcggcgctggtgggtggtttactg
ctggtgttcgctgactggtgtgggcggatggtgctgtttccattccagatcccggcgggg
ctgctgtcaacctttatcggcgcgccatattttatctatttgttgagaaagcagagccgt
taa
              
                            

Download fasta file
RegulonDB