RegulonDB RegulonDB 10.9: Gene Sequence
fhuC gene sequence


Size: 798        A: 148  T: 196  G: 246  C: 208

Fasta

 

>fhuC E. coli K12. Version NC_000913.3 GI:556503834
atgcaggaatacacgaatcattccgataccacttttgcactgcgtaatatctcctttcgt
gtgcccgggcgcacgcttttgcatccgctgtcgttaacctttcctgccgggaaagtgacc
ggtctgattggtcacaacggttctggtaaatccactctgctcaaaatgcttggccgtcat
cagccgccgtcggaaggggagattcttcttgatgcccaaccgctggaaagctggagcagc
aaagcgtttgcccgcaaagtggcttatttgccgcagcagcttcctccggcagaagggatg
accgtgcgtgaactggtggcgattggtcgttacccgtggcatggcgcgctggggcgcttt
ggggcggcagatcgcgaaaaagtcgaggaagctatctcgctggttggcttaaaaccgctg
gcgcatcggctggtcgatagtctctctggcggcgaacgtcagcgggcgtggatcgccatg
ctggtggcgcaggatagccgttgtctgttgctcgacgaaccgacctcggcgctggatatc
gcccaccaggttgatgtgctgtcgctggtgcaccgtttaagtcaggagcgtggcctgacg
gtcattgccgtgttgcacgatatcaatatggcggcacgctactgtgattatctggtcgcc
ctgcgcggcggtgaaatgattgctcagggaacgcctgcggaaattatgcgcggcgaaacc
ctcgaaatgatttatggcatcccgatgggtattttgccgcatccggcgggtgctgcacct
gtgagttttgtttattga
              
                            

Download fasta file
RegulonDB