RegulonDB RegulonDB 10.9: Gene Sequence
fhuD gene sequence


Size: 891        A: 188  T: 216  G: 254  C: 233

Fasta

 

>fhuD E. coli K12. Version NC_000913.3 GI:556503834
atgagcggcttacctcttatttcgcgccgtcgactgttaacggcgatggcgctttctccg
ttgttatggcagatgaataccgcccacgcggcggctattgatcccaatcgtattgtggcg
ctggagtggttgccggtggaattactgctggcgctcggcatcgtgccttacggcgtggcg
gataccatcaactatcgcctgtgggtcagcgaaccaccattgccggactcagtgatcgac
gtcggtttgcgcacagaacctaaccttgaactgctgaccgaaatgaaaccatcgtttatg
gtctggtcggcaggatatggcccttcaccagaaatgctggctcgtattgcgccgggtcgc
ggatttaacttcagtgacggcaaacagccgttggcgatggcgcgtaaatcgctgacggaa
atggcagatttacttaacctgcaaagcgcagcggaaacgcatttagcgcaatatgaagac
tttatccgcagcatgaaaccccgctttgtgaagcgtggtgcgcgtccgttattgctgacg
acgcttatcgatccgcgccatatgctggtcttcggtccaaacagcttgttccaggaaatt
cttgatgagtacggcatcccaaatgcctggcaaggggaaaccaacttctggggcagtacc
gccgtcagtatcgatcgtctggcggcgtataaagacgttgatgtgctctgttttgatcac
gacaacagcaaagacatggatgcgctaatggcaacgccgctgtggcaggccatgccgttt
gtccgcgccggacgctttcagcgcgtacctgcagtctggttttatggtgcgacgctctcg
gcaatgcactttgtgcgcgttctggataacgccatcggaggtaaagcgtga
              
                            

Download fasta file
RegulonDB