RegulonDB RegulonDB 10.9: Gene Sequence
fhuE gene sequence


Size: 2190        A: 585  T: 510  G: 543  C: 552

Fasta

 

>fhuE E. coli K12. Version NC_000913.3 GI:556503834
atgctttcaacacaatttaacagggataatcaatatcaagccatcaccaaaccgtcacta
cttgccggttgcatagcactggcactattaccttctgccgcttttgctgcaccagccact
gaagaaacggtgattgttgagggttcagccacagctccagatgatggcgaaaatgattac
agcgtaacgtctacctctgcgggtaccaaaatgcagatgactcaacgtgatattcctcag
tcggtcactattgttagccagcagcggatggaagatcagcagttacaaacgctgggcgaa
gtgatggaaaacacgctggggatcagcaaaagtcaggcggattccgatcgtgctctttat
tattcccgcggattccagatcgataactatatggttgatggtatccccacctattttgaa
tcgcgctggaatctgggcgacgcactttctgatatggcactctttgaacgcgtagaagta
gtgcgtggcgcgacaggactcatgaccgggacgggtaatccatctgcggcaattaatatg
gttcgaaaacacgcgaccagtcgtgaatttaaaggcgatgtctcggcggaatacggtagc
tggaacaaagaacggtatgtggcggatttacaaagcccactcaccgaagacggtaaaatc
cgcgcgcgaattgtcggcggctaccagaataacgactcatggctggaccgctacaacagt
gaaaagaccttcttctcgggcattgtcgatgctgatttaggcgatcttacgacgctttca
gccggttacgaatatcagcgcattgatgttaatagccctacctggggcggtttaccgcgc
tggaatactgatggcagcagcaacagttacgatcgcgcacgcagtaccgcacctgactgg
gcgtacaacgataaagagatcaacaaggtctttatgaccctgaagcagcagtttgctgat
acctggcaagcgacactgaatgccacccactctgaagtcgaatttgacagcaaaatgatg
tatgtcgatgcctatgtaaacaaagcggatggtatgctggttgggccatacagtaattat
ggacctggctttgattatgtcggcggcaccggttggaacagtggcaaacgtaaagttgat
gcgctggatttgttcgctgacggtagttatgaattgtttggtcgtcagcacaatctaatg
tttggtggcagttacagcaaacaaaacaatcgttacttcagttcatgggccaacatcttc
ccggatgaaattggcagtttctacaactttaatggcaatttcccacaaaccgactggtca
ccacagagcctggcgcaggacgataccacacatatgaaatcgttatatgctgccactcgt
gtcacccttgccgatccgctgcatctgatcctcggcgcacgttataccaactggcgggtt
gatacgctgacttacagcatggagaaaaaccacaccacgccttacgctggtctggtgttt
gacatcaatgacaactggtcgacctacgccagctatacctctattttccagccgcaaaat
gatcgtgacagttcaggcaaatatctggctccaatcaccggtaacaactacgagctgggt
ctgaaatcggactggatgaatagccgtctgaccaccacgttagccatcttccgtattgag
caggataatgtcgctcagtccaccggtacacctatccccggcagcaacggcgaaaccgcc
tataaagcggtggatgggacagtcagtaaaggggtggaatttgaactcaacggcgcaatt
accgacaactggcagctgacatttggcgcaacgcgctatattgcagaggataacgaagga
aacgccgttaatcctaatctgccacgcaccacggttaaaatgttcaccagctatcggttg
cctgtcatgccagagttgacggtcggcggtggtgttaactggcaaaatcgcgtgtatacc
gacaccgtgacgccgtatggcaccttccgcgccgagcaaggtagctacgcgctggtggat
ctcttcacccgctaccaggtgacgaaaaacttctcgttacaggggaacgtcaataacctg
ttcgacaaaacctacgataccaacgtggaaggttctatcgtctacggcacaccgcgtaat
ttcagcattaccggcacgtatcaattctga
              
                            

Download fasta file
RegulonDB