RegulonDB RegulonDB 10.9: Gene Sequence
lpxD gene sequence


Size: 1026        A: 254  T: 230  G: 291  C: 251

Fasta

 

>lpxD E. coli K12. Version NC_000913.3 GI:556503834
atgccttcaattcgactggctgatttagcgcagcagttggatgcagaactacacggtgat
ggcgatatcgtcatcaccggcgttgcgtccatgcaatctgcacaaacaggtcacattacg
ttcatggttaacccaaaataccgtgagcatttaggcttgtgccaggcgtccgcggttgtc
atgacccaggacgatcttcctttcgcgaaaagtgccgcactggtagtgaagaatccctac
ctgacttacgcgcgcatggcgcaaattttagataccacgccgcagcccgcgcagaacatt
gcacccagtgcggtgatcgacgcgacggcgaagctgggtaacaacgtatcgattggcgct
aacgcggtgattgagtccggcgttgaactgggcgataacgtgattatcggtgccggttgc
ttcgtaggtaaaaacagcaaaatcggtgcaggttcgcgtctctgggcgaacgtaaccatt
taccatgagatccagatcggtcagaattgcctgatccagtccggaacagtggtaggcgca
gacggctttggttatgccaacgatcgtggtaactgggtgaagatcccacagattggtcgc
gtaattattggcgatcgcgtggagatcggtgcctgcacaaccatcgatcgcggcgcgctg
gatgacactattattggcaatggcgtgatcattgataaccagtgccagattgcacataac
gtcgtgattggcgacaatacggcggttgccggtggcgtcattatggcgggcagcctgaaa
attggtcgttactgcatgatcggcggagccagcgtaatcaacgggcatatggaaatatgc
gacaaagtgacggttacgggcatgggtatggtgatgcgtcccatcactgaaccaggcgtc
tattcctcaggcattccgctgcaacccaacaaagtctggcgcaaaaccgctgcactggtg
atgaacattgatgacatgagcaagcgtctgaaatcgcttgagcgcaaggttaatcaacaa
gactaa
              
                            

Download fasta file
RegulonDB