RegulonDB RegulonDB 10.9: Gene Sequence
fis gene sequence


Size: 297        A: 88  T: 69  G: 71  C: 69

Fasta

 

>fis E. coli K12. Version NC_000913.3 GI:556503834
atgttcgaacaacgcgtaaattctgacgtactgaccgtttctaccgttaactctcaggat
caggtaacccaaaaacccctgcgtgactcggttaaacaggcactgaagaactattttgct
caactgaatggtcaggatgtgaatgacctctatgagctggtactggctgaagtagaacag
cccctgttggacatggtgatgcaatacacccgtggtaaccagacccgtgctgcgctgatg
atgggcatcaaccgtggtacgctgcgtaaaaaattgaaaaaatacggcatgaactaa
              
                            

Download fasta file
RegulonDB