RegulonDB RegulonDB 10.8: Gene Sequence
fliL gene sequence


Size: 465        A: 107  T: 110  G: 120  C: 128

Fasta

 

>fliL E. coli K12. Version NC_000913.3 GI:556503834
atgactgattacgcgataagcaagaaaagcaagcgatcgctttggatcccgattctggta
ttcattaccctcgcggcctgtgccagcgcaggttacagctactggcattcgcatcaggtt
gccgctgacgacaaagcgcagcaacgcgtcgtgccctcaccggtcttctacgcgctggat
accttcacggtcaatttgggcgatgcggatcgcgtactttatatcggcataaccctgcgc
ctgaaagatgaagctacccgctcgcggctgagtgagtatttgccggaagtccgtagtcgc
ttgctgttactgttttcgcgtcaggatgctgccgtactggcgacagaagaaggcaagaaa
aacctgattgccgagattaaaaccacactttccaccccgcttgttgccgggcaaccgaaa
caggatgtcaccgacgtgctgtataccgcttttattctgcgataa
              
                            

Download fasta file
RegulonDB