RegulonDB RegulonDB 10.9: Gene Sequence
fliM gene sequence


Size: 1005        A: 240  T: 229  G: 267  C: 269

Fasta

 

>fliM E. coli K12. Version NC_000913.3 GI:556503834
atgggcgatagtattctttctcaagctgaaattgatgcgctgttgaatggtgacagcgaa
gtcaaagacgaaccgacagccagtgttagcggcgaaagtgacattcgtccgtacgatccg
aatacccaacgacgggttgtgcgcgaacgtttgcaggcgctggaaatcattaatgagcgc
tttgcccgccattttcgtatggggctgttcaacctgctgcgtcgtagcccggatataacc
gtcggggccatccgcattcagccgtaccatgaatttgcccgcaacctgccggtgccgacc
aacctgaaccttatccatctgaaaccgctgcgcggcactgggctggtggtgttctcaccg
agtctggtgtttatcgccgtggataacctgtttggcggcgatggacgcttcccgaccaaa
gtggaaggtcgcgagtttacccataccgaacagcgcgtcatcaaccgcatgttgaaactg
gcgcttgaaggctatagcgacgcctggaaggcgattaatccgctggaagttgagtacgtg
cgttcggaaatgcaggtgaaatttaccaatatcaccacctcgccgaacgacattgtggtt
aacacgccgttccatgtggagattggcaacctgaccggcgaatttaatatctgcctgcca
ttcagcatgatcgagccgctacgggaattgttggttaacccgccgctggaaaactcgcgt
aatgaagatcagaactggcgcgataacctggtgcgccaggtgcagcattcacagctggag
ctggtcgccaactttgccgatatctcgctacgcctgtcgcagattttaaaactgaacccc
ggcgacgtcctgccgatagaaaaacccgatcgcatcatcgcccatgttgacggcgtcccg
gtgctgaccagtcagtatggcaccctcaacggtcagtatgcgttacggatagaacatttg
attaacccgattttaaattctctgaacgaggaacagcccaaatga
              
                            

Download fasta file
RegulonDB