RegulonDB RegulonDB 10.9: Gene Sequence
fnr gene sequence


Size: 753        A: 189  T: 175  G: 195  C: 194

Fasta

 

>fnr E. coli K12. Version NC_000913.3 GI:556503834
atgatcccggaaaagcgaattatacggcgcattcagtctggcggttgtgctatccattgc
caggattgcagcatcagccagctttgcatcccgttcacactcaacgaacatgagcttgat
cagcttgataatatcattgagcggaagaagcctattcagaaaggccagacgctgtttaag
gctggtgatgaacttaaatcgctttatgccatccgctccggtacgattaaaagttatacc
atcactgagcaaggcgacgagcaaatcactggtttccatttagcaggcgacctggtggga
tttgacgccatcggcagcggccatcacccgagcttcgcgcaggcgctggaaacctcgatg
gtatgtgaaatcccgttcgaaacgctggacgatttgtccggtaaaatgccgaatctgcgt
cagcagatgatgcgtctgatgagcggtgaaatcaaaggcgatcaggacatgatcctgctg
ttgtcgaagaaaaatgccgaggaacgtctggctgcattcatctacaacctgtcccgtcgt
tttgcccaacgcggcttctcccctcgtgaattccgcctgacgatgactcgtggcgatatc
ggtaactatctgggcctgacggtagaaaccatcagccgtctgctgggtcgcttccagaaa
agcggcatgctggcagtcaaaggtaaatacatcaccatcgaaaataacgatgcgctggcc
cagcttgctggtcatacgcgtaacgttgcctga
              
                            

Download fasta file
RegulonDB