RegulonDB RegulonDB 10.9: Gene Sequence
folC gene sequence


Size: 1269        A: 272  T: 286  G: 394  C: 317

Fasta

 

>folC E. coli K12. Version NC_000913.3 GI:556503834
atgattatcaaacgcactcctcaagccgcgtcgcctctggcttcgtggctttcttatctg
gaaaacctgcacagtaaaactatcgatctcggccttgagcgcgtgagcctggtcgcggcg
cgtcttggcgtcctgaaaccagcgccatttgtgtttaccgttgcgggtacgaatggcaaa
ggcaccacctgccgtacgctggagtcgattctgatggcggcagggtacaaagtgggcgtc
tacagttcgcctcatctggtgcgttataccgagcgcgtacgtgtgcagggccaggaattg
ccggaatcggcccacaccgcctcttttgcggagattgaatcggcacgcggtgatatttcc
ctgacctatttcgagtacggtacgctgtcggcgttgtggctgttcaagcaggcacaactt
gacgtggtgattctggaagtagggctgggcggtcgtctggacgcaaccaatattgtcgac
gccgatgtcgcggtagtaaccagtattgcgctggatcataccgactggctgggtccagat
cgcgaaagtattggtcgcgagaaagcaggcatcttccgcagcgaaaaaccggcaattgtc
ggtgagccggaaatgccttctaccattgctgatgtggcgcaggaaaaaggtgcactgtta
caacgtcggggcgttgagtggaactattccgtcaccgatcatgactgggcgtttagcgat
gctcacggcacgctggaaaatctgccgttgccgcttgtcccgcaaccgaatgccgcaaca
gcgctggcggcactgcgtgccagcgggctggaagtcagtgaaaatgccattcgcgacggg
attgccagcgcaattttgccgggacgtttccagattgtgagcgagtcgccacgcgttatt
tttgatgtcgcgcataatccacatgcggcggaatatctcaccgggcgtatgaaagcgcta
ccgaaaaacgggcgcgtgctggcggttatcggtatgctacatgataaagatattgccgga
actctggcctggttgaaaagcgtggttgatgactggtattgtgcgccactggaagggccg
cgcggtgccacggcagaacaactgcttgagcatttgggtaacggcaaatcatttgatagc
gttgcgcaggcatgggatgccgcaatggcggacgctaaagcggaagacaccgtgctggtg
tgtggttctttccacacggtcgcacatgtcatggaagtgattgacgcgaggagaagcggt
ggcaagtaa
              
                            

Download fasta file
RegulonDB