RegulonDB RegulonDB 10.10: Gene Sequence
folD gene sequence


Size: 867        A: 199  T: 197  G: 242  C: 229

Fasta

 

>folD E. coli K12. Version NC_000913.3 GI:556503834
atggcagcaaagattattgacggtaaaacgattgcgcagcaggtgcgctctgaagttgct
caaaaagttcaggcgcgtattgcagccggactgcgggcaccaggactggccgttgtgctg
gtgggtagtaaccctgcatcgcaaatttatgtcgcaagcaaacgcaaggcttgtgaagaa
gtcgggttcgtctcccgctcttatgacctcccggaaaccaccagcgaagcggagctgctg
gagcttatcgatacgctgaatgccgacaacaccatcgatggcattctggttcaactgccg
ttaccggcgggtattgataacgtcaaagtgctggaacgtattcatccggacaaagacgtg
gacggtttccatccttacaacgtcggtcgtctgtgccagcgcgcgccgcgtctgcgtccc
tgcaccccgcgcggtatcgtcacgctgcttgagcgttacaacattgataccttcggcctc
aacgccgtggtgattggcgcatcgaatatcgttggccgcccgatgagcatggaactgctg
ctggcaggttgcaccactacagtgactcaccgcttcactaaaaatctgcgtcatcacgta
gaaaatgccgatctattgatcgttgccgttggcaagccaggctttattcccggtgactgg
atcaaagaaggcgcaattgtgattgatgtcggcatcaaccgtctggaaaatggcaaagtt
gtgggcgacgtcgtgtttgaagacgcggctaaacgcgcctcatacattacgcctgttccc
ggcggcgttggcccgatgacggttgccacgctgattgaaaacacgctacaggcgtgcgtt
gaatatcatgatccacaggatgagtaa
              
                            

Download fasta file
RegulonDB