RegulonDB RegulonDB 10.10: Gene Sequence
frdA gene sequence


Size: 1809        A: 422  T: 367  G: 529  C: 491

Fasta

 

>frdA E. coli K12. Version NC_000913.3 GI:556503834
gtgcaaacctttcaagccgatcttgccattgtaggcgccggtggcgcgggattacgtgct
gcaattgctgccgcgcaggcaaatccgaatgcaaaaatcgcactaatctcaaaagtatac
ccgatgcgtagccataccgttgctgcagaagggggctccgccgctgtcgcgcaggatcat
gacagcttcgaatatcactttcacgatacagtagcgggtggcgactggttgtgtgagcag
gatgtcgtggattatttcgtccaccactgcccaaccgaaatgacccaactggaactgtgg
ggatgcccatggagccgtcgcccggatggtagcgtcaacgtacgtcgcttcggcggcatg
aaaatcgagcgcacctggttcgccgccgataagaccggcttccatatgctgcacacgctg
ttccagacctctctgcaattcccgcagatccagcgttttgacgaacatttcgtgctggat
attctggttgatgatggtcatgttcgcggcctggtagcaatgaacatgatggaaggcacg
ctggtgcagatccgtgctaacgcggtcgttatggctactggcggtgcgggtcgcgtttat
cgttacaacaccaacggcggcatcgttaccggtgacggtatgggtatggcgctaagccac
ggcgttccgctgcgtgacatggaattcgttcagtatcacccaaccggtctgccaggttcc
ggtatcctgatgaccgaaggttgccgcggtgaaggcggtattctggtcaacaaaaatggc
taccgttatctgcaagattacggcatgggcccggaaactccgctgggcgagccgaaaaac
aaatatatggaactgggtccacgcgacaaagtctctcaggccttctggcacgaatggcgt
aaaggcaacaccatctccacgccgcgtggcgatgtggtttatctcgacttgcgtcacctc
ggcgagaaaaaactgcatgaacgtctgccgttcatctgcgaactggcgaaagcgtacgtt
ggcgtcgatccggttaaagaaccgattccggtacgtccgaccgcacactacaccatgggc
ggtatcgaaaccgatcagaactgtgaaacccgcattaaaggtctgttcgccgtgggtgaa
tgttcctctgttggtctgcacggtgcaaaccgtctgggttctaactccctggcggaactg
gtggtcttcggccgtctggccggtgaacaagcgacagagcgtgcagcaactgccggtaat
ggcaacgaagcggcaattgaagcgcaggcagctggcgttgaacaacgtctgaaagatctg
gttaaccaggatggcggcgaaaactgggcgaagatccgcgacgaaatgggcctggctatg
gaagaaggctgcggtatctaccgtacgccggaactgatgcagaaaaccatcgacaagctg
gcagagctgcaggaacgcttcaagcgcgtgcgcatcaccgacacttccagcgtgttcaac
accgacctgctctacaccattgaactgggccacggtctgaacgttgctgaatgtatggcg
cactccgcaatggcacgtaaagagtcccgcggcgcgcaccagcgtctggacgaaggttgc
accgagcgtgacgacgtcaacttcctcaaacacaccctcgccttccgcgatgctgatggc
acgactcgcctggagtacagcgacgtgaagattactacgctgccgccagctaaacgcgtt
tacggtggcgaagcggatgcagccgataaggcggaagcagccaataagaaggagaaggcg
aatggctga
              
                            

Download fasta file
RegulonDB