RegulonDB RegulonDB 10.9: Gene Sequence
frdD gene sequence


Size: 360        A: 60  T: 104  G: 107  C: 89

Fasta

 

>frdD E. coli K12. Version NC_000913.3 GI:556503834
atgattaatccaaatccaaagcgttctgacgaaccggtattctggggcctcttcggggcc
ggtggtatgtggagcgccatcattgcgccggtgatgatcctgctggtgggtattctgctg
ccactggggttgtttccgggtgatgcgctgagctacgagcgcgttctggcgttcgcgcag
agcttcattggtcgcgtattcctgttcctgatgatcgttctgccgctgtggtgtggttta
caccgtatgcaccacgcgatgcacgatctgaaaatccacgtacctgcgggcaaatgggtt
ttctacggtctggctgctatcctgacagttgtcacgctgattggtgtcgttacaatctaa
              
                            

Download fasta file
RegulonDB