RegulonDB RegulonDB 10.9: Gene Sequence
frr gene sequence


Size: 558        A: 163  T: 111  G: 154  C: 130

Fasta

 

>frr E. coli K12. Version NC_000913.3 GI:556503834
gtgattagcgatatcagaaaagatgctgaagtacgcatggacaaatgcgtagaagcgttc
aaaacccaaatcagcaaaatacgcacgggtcgtgcttctcccagcctgctggatggcatt
gtcgtggaatattacggcacgccgacgccgctgcgtcagctggcaagcgtaacggtagaa
gattcccgtacactgaaaatcaacgtgtttgatcgttcaatgtctccggccgttgaaaaa
gcgattatggcgtccgatcttggcctgaacccgaactctgcgggtagcgacatccgtgtt
ccgctgccgccgctgacggaagaacgtcgtaaagatctgaccaaaatcgttcgtggtgaa
gcagaacaagcgcgtgttgcagtacgtaacgtgcgtcgtgacgcgaacgacaaagtgaaa
gcactgttgaaagataaagagatcagcgaagacgacgatcgccgttctcaggacgatgta
cagaaactgactgatgctgcaatcaagaaaattgaagcggcgctggcagacaaagaagca
gaactgatgcagttctga
              
                            

Download fasta file
RegulonDB