RegulonDB RegulonDB 10.9: Gene Sequence
fruA gene sequence


Size: 1692        A: 349  T: 400  G: 536  C: 407

Fasta

 

>fruA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacgctgctgattattgacgctaatctcggtcaggcacgcgcctatatggcgaag
accctgctgggcgcggcggcgcgaaaagcaaaactggaaatcatcgacaatccgaacgac
gctgaaatggcgattgttctcggtgattccatcccgaacgacagcgcgctgaacggtaaa
aatgtctggctgggcgatatttcccgggcagttgcgcaccctgagctgttcctgagtgaa
gccaaaggccatgcgaaaccttacactgcgccggtcgctgcgacagcaccagttgccgcc
agcggtccgaaacgcgtagttgcggtgactgcttgcccgactggcgtagcacacaccttt
atggcggctgaagccattgaaaccgaagcgaaaaaacgtggctggtgggtgaaagttgaa
acccgtggttctgttggcgcgggtaatgcaatcactcccgaagaagtcgcagcagcggat
ctggtgattgtggcggcagatatcgaagtggatctggcgaaatttgctggtaaaccgatg
tatcgtacctctaccggtctggcgctgaagaaaaccgcgcaggaactggataaagcggtt
gctgaagcaacgccgtatgaaccggcgggcaaagctcaaacggcgaccactgaaagtaag
aaagagagtgcaggcgcataccgtcacttgctgacgggcgtttcttacatgctgccgatg
gtcgttgcaggtggtctgtgtatcgcgctttcttttgcttttggtatcgaagcgtttaaa
gagccgggtacgttggctgcggcgctgatgcagattggtggtggttcagcctttgcgctg
atggtgccggtactggcaggttatattgccttttccattgccgatcgtccgggcctcact
ccgggtctgattggcggtatgctggcggtcagcaccggttctggcttcattggtggtatt
attgcgggcttcctggctggttacattgcgaagttaatcagtacgcaattgaaactgcca
cagagtatggaggcgctgaaaccgatcctgatcattccgctaatttccagtctggtggtc
ggtctggcgatgatctacctgatcggtaaaccagttgctggcattctcgaagggctgact
cactggctgcagaccatggggactgcgaatgcggttctgctgggggcgatcctcggtggc
atgatgtgtactgacatgggcggtccggtaaacaaagcagcgtacgcattcggtgtgggt
ctgctgagtactcaaacctatggcccgatggcggcgattatggcggcaggtatggtgcca
ccgctggcaatgggtctggcaacaatggtggcgcgtcgcaaattcgacaaagcgcagcag
gaaggtggcaaagccgctctggtattgggactgtgcttcatttcggaaggtgcaattccg
tttgctgctcgtgatccgatgcgtgtgctgccgtgctgtatcgtgggtggggcgctgact
ggcgcaatctcaatggcgattggtgcgaaactgatggcaccgcacggtggtctgtttgtt
ctgctgatccctggcgctattacgccggtattgggttacctggtagcaattattgccggt
acgctggtggcgggtttggcctatgccttcctgaaacgtccggaagtggacgcagtagcg
aaagcagcgtaa
              
                            

Download fasta file
RegulonDB