RegulonDB RegulonDB 10.9: Gene Sequence
fruK gene sequence


Size: 939        A: 212  T: 225  G: 275  C: 227

Fasta

 

>fruK E. coli K12. Version NC_000913.3 GI:556503834
atgagcagacgtgttgctactatcacccttaatccggcttatgaccttgttggtttctgc
ccggaaattgaacgcggcgaagtgaacctggtgaaaaccaccggtctgcatgcggcgggt
aaaggcatcaacgtggccaaagtattaaaagacctgggaattgatgtcaccgttggcggc
ttcctgggtaaagacaatcaggatggttttcagcaactgttcagcgagctgggcattgcc
aaccgtttccaggttgtacaggggcgcacccgaattaacgttaagctgacggaaaaagac
ggcgaagtgaccgacttcaacttctcgggttttgaagtcacccccgccgactgggaacgc
tttgtgactgattctctgagctggctcggtcagttcgatatggtctgtgtcagcggaagc
ttaccgtcaggcgtcagcccggaagcgttcaccgactggatgactcgcctgcgtagtcag
tgtccttgcattatctttgatagtagccgtgaagcgttagtagcaggtttgaaagcggca
ccgtggctggtgaaacctaaccgccgcgagctggaaatctgggcaggccgtaaactgcct
gaaatgaaagatgtgattgaagctgcacatgcgctacgtgaacaaggcatcgcgcatgtt
gttatttcactgggtgccgaaggcgcgctttgggttaatgcctccggcgaatggatcgcc
aaaccaccgtcagtcgatgtcgtaagcaccgttggcgcaggggattctatggttggtggc
ctgatttatggcttgctgatgcgtgaatccagtgaacacacactgcgtctggcgacagct
gttgcagccctggcggtaagtcaaagcaatgtgggtattaccgatcgtccgcagttggcc
gcaatgatggcgcgcgtcgacttacaaccttttaactga
              
                            

Download fasta file
RegulonDB