RegulonDB RegulonDB 11.1: Gene Sequence
ftsQ gene sequence


Size: 831        A: 211  T: 177  G: 249  C: 194

Fasta

 

>ftsQ E. coli K12. Version NC_000913.3 GI:556503834
atgtcgcaggctgctctgaacacgcgaaacagcgaagaagaggtttcttctcgccgcaat
aatggaacgcgtctggcggggatccttttcctgctgaccgttttaacgacagtgttggtg
agcggctgggtcgtgttgggctggatggaagatgcgcaacgcctgccgctctcaaagctg
gtgttgaccggtgaacgccattacacacgtaatgacgatatccggcagtcgatcctggca
ttgggtgagccgggtacctttatgacccaggatgtcaacatcatccagacgcaaatagaa
caacgcctgccgtggattaagcaggtgagcgtcagaaagcagtggcctgatgaattgaag
attcatctggttgaatatgtgccgattgcgcggtggaatgatcaacatatggtagacgcg
gaaggaaataccttcagcgtgccgccagaacgcaccagcaagcaggtgcttccaatgctg
tatggcccggaaggcagcgccaatgaagtgttgcagggctatcgcgaaatggggcagatg
ctggcaaaggacagatttactctgaaggaagcggcgatgaccgcgcggcgttcctggcag
ttgacgctgaataacgatattaagctcaatcttggccggggcgatacgatgaaacgtttg
gctcgctttgtagaactttatccggttttacagcagcaggcgcaaaccgatggcaaacgg
attagctacgttgatttgcgttatgactctggagcggcagtaggctgggcgcccttgccg
ccagaggaatctactcagcaacaaaatcaggcacaggcagaacaacaatga
              
                            

Download fasta file
RegulonDB