RegulonDB RegulonDB 11.1: Gene Sequence
ftsZ gene sequence


Size: 1152        A: 267  T: 261  G: 354  C: 270

Fasta

 

>ftsZ E. coli K12. Version NC_000913.3 GI:556503834
atgtttgaaccaatggaacttaccaatgacgcggtgattaaagtcatcggcgtcggcggc
ggcggcggtaatgctgttgaacacatggtgcgcgagcgcattgaaggtgttgaattcttc
gcggtaaataccgatgcacaagcgctgcgtaaaacagcggttggacagacgattcaaatc
ggtagcggtatcaccaaaggactgggcgctggcgctaatccagaagttggccgcaatgcg
gctgatgaggatcgcgatgcattgcgtgcggcgctggaaggtgcagacatggtctttatt
gctgcgggtatgggtggtggtaccggtacaggtgcagcaccagtcgtcgctgaagtggca
aaagatttgggtatcctgaccgttgctgtcgtcactaagcctttcaactttgaaggcaag
aagcgtatggcattcgcggagcaggggatcactgaactgtccaagcatgtggactctctg
atcactatcccgaacgacaaactgctgaaagttctgggccgcggtatctccctgctggat
gcgtttggcgcagcgaacgatgtactgaaaggcgctgtgcaaggtatcgctgaactgatt
actcgtccgggtttgatgaacgtggactttgcagacgtacgcaccgtaatgtctgagatg
ggctacgcaatgatgggttctggcgtggcgagcggtgaagaccgtgcggaagaagctgct
gaaatggctatctcttctccgctgctggaagatatcgacctgtctggcgcgcgcggcgtg
ctggttaacatcacggcgggcttcgacctgcgtctggatgagttcgaaacggtaggtaac
accatccgtgcatttgcttccgacaacgcgactgtggttatcggtacttctcttgacccg
gatatgaatgacgagctgcgcgtaaccgttgttgcgacaggtatcggcatggacaaacgt
cctgaaatcactctggtgaccaataagcaggttcagcagccagtgatggatcgctaccag
cagcatgggatggctccgctgacccaggagcagaagccggttgctaaagtcgtgaatgac
aatgcgccgcaaactgcgaaagagccggattatctggatatcccagcattcctgcgtaag
caagctgattaa
              
                            

Download fasta file
RegulonDB