RegulonDB RegulonDB 10.9: Gene Sequence
fucA gene sequence


Size: 648        A: 170  T: 160  G: 170  C: 148

Fasta

 

>fucA E. coli K12. Version NC_000913.3 GI:556503834
atggaacgaaataaacttgctcgtcagattattgacacttgcctggaaatgacccgcctg
ggactgaaccaggggacagcggggaacgtcagtgtacgttatcaggatgggatgctgatt
acgcctacaggcattccatatgaaaaactgacggagtcgcatattgtctttattgatggc
aacggtaaacatgaggaaggaaagctcccctcaagcgaatggcgtttccatatggcagcc
tatcaaagcagaccggatgccaacgcggttgttcacaatcatgccgttcattgcacggca
gtttccattcttaaccgatcgatccccgctattcactacatgattgcggcggctggcggt
aattctattccttgcgcgccttatgcgacctttggaacacgcgaactttctgaacatgtt
gcgctggctctcaaaaatcgtaaggcaactttgttacaacatcatgggcttatcgcttgt
gaggtgaatctggaaaaagcgttatggctggcgcatgaagttgaagtgctggcgcaactt
tacctgacgaccctggcgattacggacccggtgccagtgctgagcgatgaagagattgcc
gtagtgctggagaaattcaaaacctatgggttacgaattgaagagtaa
              
                            

Download fasta file
RegulonDB