RegulonDB RegulonDB 10.9: Gene Sequence
fucI gene sequence


Size: 1776        A: 428  T: 380  G: 487  C: 481

Fasta

 

>fucI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaatcagcttaccgaaaattggtatccgcccggttattgacggtcgtcgcatg
ggtgttcgtgagtcgcttgaagaacaaacaatgaatatggcgaaagctacggccgcactg
ctgaccgagaaactgcgccatgcctgcggagctgccgtcgagtgtgtcatttccgatacc
tgtatcgcgggtatggctgaagccgctgcttgcgaagaaaaattcagcagtcagaatgta
ggcctcaccattacggtaacgccttgctggtgctatggcagtgaaaccatcgacatggat
ccaacccgcccgaaggccatttggggctttaacggcactgaacgccccggcgctgtttac
ctggcagcggctctggcagctcacagccagaaaggcatcccagcattctccatttacggt
catgacgttcaggatgccgatgacacatcgattcctgccgatgttgaagaaaaactgctg
cgctttgcccgcgccggtttggccgtcgccagcatgaaaggtaaaagctatctgtcgctg
ggcggcgtttcgatgggtatcgccggttccattgttgatcacaacttctttgaatcctgg
ctgggaatgaaagtccaggcggtggatatgaccgaactgcgtcgccgtatcgatcagaag
atttacgacgaagccgaattggaaatggcactggcctgggctgataaaaacttccgctat
ggcgaagatgaaaataacaaacagtatcaacgtaatgccgagcaaagccgcgcagttctg
cgcgaaagtttactgatggcgatgtgtatccgcgacatgatgcaaggcaacagcaaactg
gccgatattggtcgcgtggaagaatcacttggctacaacgccatcgctgcgggcttccag
gggcaacgtcactggaccgatcaatatcccaatggtgacaccgccgaagcgatcctcaac
agttcatttgactggaatggcgtgcgcgaaccctttgtcgtggcgaccgaaaacgacagt
cttaacggcgtggcaatgctaatgggtcaccagctcaccggcaccgctcaggtatttgcc
gatgtgcgtacctactggtcaccagaagcaattgagcgtgtaacggggcataaactggat
ggactggcagaacacggcatcatccatttgatcaactccggttctgctgcgctggacggt
tcctgtaaacaacgcgacagcgaaggtaacccgacgatgaagccacactgggaaatctct
cagcaagaggctgacgcttgcctcgccgctaccgaatggtgcccggcgatccacgaatac
ttccgtggcggcggttactcttcccgcttccttaccgaaggcggcgtcccgttcaccatg
actcgtgtcaacatcatcaaaggcctgggaccggtactgcaaatcgcggaaggctggagc
gtggaattgccgaaggatgtgcatgacatcctcaacaaacgcaccaactcaacctggcca
accacctggtttgcaccgcgcctcaccggtaaagggccgtttacggatgtgtactcggta
atggcgaactggggcgctaaccatggggttctgaccatcggccacgttggcgcagacttt
atcactctcgcctccatgctgcgtatcccggtatgtatgcacaacgttgaagagaccaaa
gtgtatcgtccttctgcctgggctgcgcacggcatggatattgaaggccaggattaccgc
gcttgccagaactacggtccgttgtacaagcgttaa
              
                            

Download fasta file
RegulonDB