RegulonDB RegulonDB 10.9: Gene Sequence
fucO gene sequence


Size: 1149        A: 259  T: 275  G: 360  C: 255

Fasta

 

>fucO E. coli K12. Version NC_000913.3 GI:556503834
atggctaacagaatgattctgaacgaaacggcatggtttggtcggggtgctgttggggct
ttaaccgatgaggtgaaacgccgtggttatcagaaggcgctgatcgtcaccgataaaacg
ctggtgcaatgcggcgtggtggcgaaagtgaccgataagatggatgctgcagggctggca
tgggcgatttacgacggcgtagtgcccaacccaacaattactgtcgtcaaagaagggctc
ggtgtattccagaatagcggcgcggattacctgatcgctattggtggtggttctccacag
gatacttgtaaagcgattggcattatcagcaacaacccggagtttgccgatgtgcgtagc
ctggaagggctttccccgaccaataaacccagtgtaccgattctggcaattcctaccaca
gcaggtactgcggcagaagtgaccattaactacgtgatcactgacgaagagaaacggcgc
aagtttgtttgcgttgatccgcatgatatcccgcaggtggcgtttattgacgctgacatg
atggatggtatgcctccagcgctgaaagctgcgacgggtgtcgatgcgctcactcatgct
attgaggggtatattacccgtggcgcgtgggcgctaaccgatgcactgcacattaaagcg
attgaaatcattgctggggcgctgcgaggatcggttgctggtgataaggatgccggagaa
gaaatggcgctcgggcagtatgttgcgggtatgggcttctcgaatgttgggttagggttg
gtgcatggtatggcgcatccactgggcgcgttttataacactccacacggtgttgcgaac
gccatcctgttaccgcatgtcatgcgttataacgctgactttaccggtgagaagtaccgc
gatatcgcgcgcgttatgggcgtgaaagtggaaggtatgagcctggaagaggcgcgtaat
gccgctgttgaagcggtgtttgctctcaaccgtgatgtcggtattccgccacatttgcgt
gatgttggtgtacgcaaggaagacattccggcactggcgcaggcggcactggatgatgtt
tgtaccggtggcaacccgcgtgaagcaacgcttgaggatattgtagagctttaccatacc
gcctggtaa
              
                            

Download fasta file
RegulonDB