RegulonDB RegulonDB 10.9: Gene Sequence
fucP gene sequence


Size: 1317        A: 299  T: 390  G: 297  C: 331

Fasta

 

>fucP E. coli K12. Version NC_000913.3 GI:556503834
atgggaaacacatcaatacaaacgcagagttaccgtgcggtagataaagatgcagggcaa
agcagaagttacattattccattcgcgctgctgtgctcactgttttttctttgggcggta
gccaataaccttaacgacattttattacctcaattccagcaggcttttacgctgacaaat
ttccaggctggcctgatccaatcggccttttactttggttatttcattatcccaatccct
gctgggatattgatgaaaaaactcagttataaagcagggattattaccgggttattttta
tatgccttgggtgctgcattattctggcccgccgcagaaataatgaactacaccttgttt
ttagttggcctatttattattgcagccggattaggttgtctggaaactgccgcaaaccct
tttgttacggtattagggccggaaagtagtggtcacttccgcttaaatcttgcgcaaaca
tttaactcgtttggcgcaattatcgcggttgtctttgggcaaagtcttattttgtctaac
gtgccacatcaatcgcaagacgttctcgataaaatgtctccagagcaattgagtgcgtat
aaacacagcctggtattatcggtacagacaccttatatgatcatcgtggctatcgtgtta
ctggtcgccctgctgatcatgctgacgaaattcccggcattgcagagtgataatcacagt
gacgccaaacaaggatcgttctccgcatcgctttctcgcctggcgcgtattcgccactgg
cgctgggcggtattagcgcaattctgctatgtcggcgcacaaacggcctgctggagctat
ttgattcgctacgctgtagaagaaattccaggtatgactgcaggctttgccgctaactat
ttaaccggaaccatggtgtgcttctttattggtcgtttcaccggtacctggctcatcagt
cgcttcgcaccacacaaagtcctggccgcctacgcattaatcgctatggcactgtgcctg
atctcagccttcgctggcggtcatgtgggcttaatagccctgactttatgcagcgccttt
atgtcgattcagtacccaacaatcttctcgctgggcattaagaatctcggccaggacacc
aaatatggttcgtccttcatcgttatgaccattattggcggcggtattgtcactccggtc
atgggttttgtcagtgacgcggcgggcaacatccccactgctgaactgatccccgcactc
tgcttcgcggtcatctttatctttgcccgtttccgttctcaaacggcaactaactga
              
                            

Download fasta file
RegulonDB