RegulonDB RegulonDB 10.9: Gene Sequence
fucR gene sequence


Size: 732        A: 204  T: 175  G: 173  C: 180

Fasta

 

>fucR E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcggcacgccagcaagcgatagtcgacctgctgctgaaccataccagcctgacc
acggaagctctctctgaacagctaaaggtcagtaaagaaaccattcgtcgcgatctcaat
gaattacagacgcagggtaaaattctgcgcaatcatggacgcgctaaatatatccaccgt
caaaatcaagacagtggcgatccctttcacatcaggctgaaaagccattatgcgcataaa
gcagatatcgcgcgcgaggcgctcgcgtggattgaagaagggatggtgatagccttagac
gccagttcaacttgctggtatctggcacgccagttgcctgacatcaacattcaggtcttc
accaatagccatccgatttgccatgaactcggtaaacgcgaacgcattcaactgatcagt
tccggcggcacacttgagcgcaaatatggctgttacgtcaatccctcgctgatttcccaa
cttaaatcgctggaaatcgatctgtttattttttcttgtgaagggatcgatagcagcggc
gcactgtgggactccaatgcgatcaacgctgattacaaatcgatgctattaaaacgtgcc
gcgcaatcgttgttattgattgataaaagtaaatttaatcgttcaggggaagcccgcatc
gggcatctggatgaggtaacgcacattatttctgatgagcgccaggttgcaacttctttg
gtaacagcctga
              
                            

Download fasta file
RegulonDB