RegulonDB RegulonDB 10.9: Gene Sequence
fucU gene sequence


Size: 423        A: 106  T: 110  G: 108  C: 99

Fasta

 

>fucU E. coli K12. Version NC_000913.3 GI:556503834
atgctgaaaacaatttcgccgttaatttctcccgaactattgaaagtgctggcagagatg
ggacatggagatgaaattattttttccgatgctcactttcccgcccattcgatgggaccg
caggtgatccgcgctgatggcctgttggtgagcgacttgctccaggcgattatcccgtta
tttgaactggacagttatgcaccgccgctggtgatgatggcggcggtagaaggtgacact
ctcgatcctgaagtagaacgacgttaccgtaatgcgctttcactacaagccccgtgtcct
gacatcatccgcatcaatcgttttgcgttttatgaacgggcgcaaaaagcctttgcgatc
gttatcacaggcgaacgagcgaagtacgggaatattcttttaaaaaaaggggtaacaccg
taa
              
                            

Download fasta file
RegulonDB