RegulonDB RegulonDB 10.9: Gene Sequence
fumB gene sequence


Size: 1647        A: 430  T: 317  G: 423  C: 477

Fasta

 

>fumB E. coli K12. Version NC_000913.3 GI:556503834
atgtcaaacaaaccctttatctaccaggcacctttcccgatggggaaagacaataccgaa
tactatctactcacttccgattacgttagcgttgccgacttcgacggcgaaaccatcctg
aaagtggaaccagaagccctgaccctgctggcgcagcaagcctttcacgacgcttctttt
atgctccgcccggcacaccagaaacaggttgcggctattcttcacgatccagaagccagc
gaaaacgacaagtacgtggcgctgcaattcttaagaaactccgaaatcgccgccaaaggc
gtgctgccgacctgccaggataccggcaccgcgatcatcgtcggtaaaaaaggccagcgc
gtgtggaccggcggcggtgatgaagaaacgctgtcgaaaggcgtctataacacctatatc
gaagataacctgcgctattcacagaatgcggcgctggacatgtacaaagaggtcaacacc
ggcactaacctgcctgcgcaaatcgacctgtacgcggtagatggcgatgagtacaaattc
ctttgcgttgcgaaaggcggcggctctgccaacaaaacgtatctctaccaggaaaccaaa
gccctgctgactcccggcaaactgaaaaacttcctcgtcgagaaaatgcgtaccctcggt
actgcagcctgcccgccgtaccatatcgcgtttgtgattggcggtacgtctgcggaaacc
aacctgaaaaccgtcaagttagcaagcgctcactattacgatgaactgccgacggaaggg
aacgaacatggtcaggcgttccgcgatgtccagctggaacaggaactgctggaagaggcc
cagaaactcggtcttggcgcgcagtttggcggtaaatacttcgcgcacgacattcgcgtt
atccgtctgccacgtcacggcgcatcctgcccggtcggcatgggcgtctcctgctccgct
gaccgtaacattaaagcgaaaatcaaccgcgaaggtatctggatcgaaaaactggaacac
aacccaggccagtacattccacaagaactgcgccaggccggtgaaggcgaagcggtgaaa
gttgaccttaaccgcccgatgaaagagatcctcgcccagctttcgcaatacccggtatcc
actcgtttgtcgctcaccggcaccattatcgtgggccgagatattgcacacgccaagctg
aaagagctgattgacgccggtaaagaacttccgcagtacatcaaagatcacccgatctac
tacgcgggtccggcgaaaacccctgccggttatccatcaggttcacttggcccaaccacc
gcaggccgtatggactcctacgtggatctgctgcaatcccacggcggcagcatgatcatg
ctggcgaaaggtaaccgcagtcagcaggttaccgacgcgtgtcataaacacggcggcttc
tacctcggtagcatcggcggtccggcggcggtactggcgcagcagagcatcaagcatctg
gagtgcgtcgcttatccggagctgggtatggaagctatctggaaaatcgaagtagaagat
ttcccggcgtttatcctggtcgatgacaaaggtaacgacttcttccagcaaatcgtcaac
aaacagtgcgcgaactgcactaagtaa
              
                            

Download fasta file
RegulonDB