RegulonDB RegulonDB 10.9: Gene Sequence
fumC gene sequence


Size: 1404        A: 358  T: 291  G: 404  C: 351

Fasta

 

>fumC E. coli K12. Version NC_000913.3 GI:556503834
atgaatacagtacgcagcgaaaaagattcgatgggggcgattgatgtcccggcagataag
ctgtggggcgcacaaactcaacgctcgctggagcatttccgcatttcgacggagaaaatg
cccacctcactgattcatgcgctggcgctaaccaagcgtgcagcggcaaaagttaatgaa
gatttaggcttgttgtctgaagagaaagcgagcgccattcgtcaggcggcggatgaagta
ctggcaggacagcatgacgacgaattcccgctggctatctggcagaccggctccggcacg
caaagtaacatgaacatgaacgaagtgctggctaaccgggccagtgaattactcggcggt
gtgcgcgggatggaacgtaaagttcaccctaacgacgacgtgaacaaaagccaaagttcc
aacgatgtctttccgacggcgatgcacgttgcggcgctgctggcgctgcgcaagcaactc
attcctcagcttaaaaccctgacacagacactgaatgagaaatcccgtgcttttgccgat
atcgtcaaaattggtcgtactcacttgcaggatgccacgccgttaacgctggggcaggag
atttccggctgggtagcgatgctcgagcataatctcaaacatatcgaatacagcctgcct
cacgtagcggaactggctcttggcggtacagcggtgggtactggactaaatacccatccg
gagtatgcgcgtcgcgtagcagatgaactggcagtcattacctgtgcaccgtttgttacc
gcgccgaacaaatttgaagcgctggcgacctgtgatgccctggttcaggcgcacggcgcg
ttgaaagggttggctgcgtcactgatgaaaatcgccaatgatgtccgctggctggcctct
ggcccgcgctgcggaattggtgaaatctcaatcccggaaaatgagccgggcagctcaatc
atgccggggaaagtgaacccaacacagtgtgaggcattaaccatgctctgctgtcaggtg
atggggaacgacgtggcgatcaacatggggggcgcttccggtaactttgaactgaacgtc
ttccgtccaatggtgatccacaatttcctgcaatcggtgcgcttgctggcagatggcatg
gaaagttttaacaaacactgcgcagtgggtattgaaccgaatcgtgagcgaatcaatcaa
ttactcaatgaatcgctgatgctggtgactgcgcttaacacccacattggttatgacaaa
gccgccgagatcgccaaaaaagcgcataaagaagggctgaccttaaaagctgcggccctt
gcgctggggtatcttagcgaagccgagtttgacagctgggtacggccagaacagatggtc
ggcagtatgaaagccgggcgttaa
              
                            

Download fasta file
RegulonDB