RegulonDB RegulonDB 10.8: Gene Sequence
fur gene sequence


Size: 447        A: 130  T: 103  G: 104  C: 110

Fasta

 

>fur E. coli K12. Version NC_000913.3 GI:556503834
atgactgataacaataccgccctaaagaaagctggcctgaaagtaacgcttcctcgttta
aaaatcctggaagttcttcaggagccggacaaccatcacgtcagtgcggaagatttatac
aaacgtctgatcgatatgggtgaagaaattggtctggctacggtatatcgcgtactgaac
cagtttgacgacgctggtatcgtcacccgccacaattttgaaggcggtaaatccgtattt
gaactgacacagcaacatcaccacgatcacctgatctgcctcgactgcggcaaggttatc
gaatttagtgatgattccatcgaagcgcgtcagcgtgaaattgccgcaaaacatggcatt
cgcctgactaaccacagtctctatctttacggtcactgtgccgaaggcgattgccgcgaa
gatgaacatgcgcacgaaggcaaataa
              
                            

Download fasta file
RegulonDB