RegulonDB RegulonDB 10.9: Gene Sequence
galE gene sequence


Size: 1017        A: 252  T: 212  G: 269  C: 284

Fasta

 

>galE E. coli K12. Version NC_000913.3 GI:556503834
atgagagttctggttaccggtggtagcggttacattggaagtcatacctgtgtgcaatta
ctgcaaaacggtcatgatgtcatcattcttgataacctctgtaacagtaagcgcagcgta
ctgcctgttatcgagcgtttaggcggcaaacatccaacgtttgttgaaggcgatattcgt
aacgaagcgttgatgaccgagatcctgcacgatcacgctatcgacaccgtgatccacttc
gccgggctgaaagccgtgggcgaatcggtacaaaaaccgctggaatattacgacaacaat
gtcaacggcactctgcgcctgattagcgccatgcgcgccgctaacgtcaaaaactttatt
tttagctcctccgccaccgtttatggcgatcagcccaaaattccatacgttgaaagcttc
ccgaccggcacaccgcaaagcccttacggcaaaagcaagctgatggtggaacagatcctc
accgatctgcaaaaagcccagccggactggagcattgccctgctgcgctacttcaacccg
gttggcgcgcatccgtcgggcgatatgggcgaagatccgcaaggcattccgaataacctg
atgccatacatcgcccaggttgctgtaggccgtcgcgactcgctggcgatttttggtaac
gattatccgaccgaagatggtactggcgtacgcgattacatccacgtaatggatctggcg
gacggtcacgtcgtggcgatggaaaaactggcgaacaagccaggcgtacacatctacaac
ctcggcgctggcgtaggcaacagcgtgctggacgtggttaatgccttcagcaaagcctgc
ggcaaaccggttaattatcattttgcaccgcgtcgcgagggcgaccttccggcctactgg
gcggacgccagcaaagccgaccgtgaactgaactggcgcgtaacgcgcacactcgatgaa
atggcgcaggacacctggcactggcagtcacgccatccacagggatatcccgattaa
              
                            

Download fasta file
RegulonDB